Incidental Mutation 'R4667:Dse'
ID 352057
Institutional Source Beutler Lab
Gene Symbol Dse
Ensembl Gene ENSMUSG00000039497
Gene Name dermatan sulfate epimerase
Synonyms Sart2, B130024B19Rik, DS-epi1
MMRRC Submission 042012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R4667 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 34027389-34083711 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 34029008 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 694 (Y694S)
Ref Sequence ENSEMBL: ENSMUSP00000040074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048010] [ENSMUST00000217051]
AlphaFold Q8BLI4
Predicted Effect probably damaging
Transcript: ENSMUST00000048010
AA Change: Y694S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040074
Gene: ENSMUSG00000039497
AA Change: Y694S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4962 24 353 5.2e-11 PFAM
low complexity region 558 568 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 935 952 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216774
Predicted Effect probably benign
Transcript: ENSMUST00000217051
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor-rejection antigen. It is localized to the endoplasmic reticulum and functions to convert D-glucuronic acid to L-iduronic acid during the biosynthesis of dermatan sulfate. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. Mutations in this gene cause inmusculocontractural Ehlers-Danlos syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 9, and a paralogous gene exists on chromosome 18. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length with altered skin morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Adgra3 T A 5: 50,136,298 (GRCm39) Y729F possibly damaging Het
Ago2 A G 15: 73,018,265 (GRCm39) Y58H probably damaging Het
Akap13 A G 7: 75,378,842 (GRCm39) T2128A probably damaging Het
Ankhd1 C A 18: 36,781,074 (GRCm39) P2042Q possibly damaging Het
Arhgef15 T C 11: 68,845,387 (GRCm39) K155R probably benign Het
Atp10b T C 11: 43,138,345 (GRCm39) F1209L probably damaging Het
B130006D01Rik A T 11: 95,617,335 (GRCm39) probably benign Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Bnip5 G T 17: 29,127,287 (GRCm39) Q241K possibly damaging Het
Btbd17 A G 11: 114,684,683 (GRCm39) F119L possibly damaging Het
Ccdc191 G T 16: 43,751,646 (GRCm39) K267N probably damaging Het
Cd200l1 A G 16: 45,264,526 (GRCm39) S11P probably benign Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Cemip2 G A 19: 21,774,715 (GRCm39) R119H probably benign Het
Cemip2 C T 19: 21,822,145 (GRCm39) A1180V probably benign Het
Chd9 T C 8: 91,760,428 (GRCm39) S2058P possibly damaging Het
Clcn6 T C 4: 148,108,624 (GRCm39) E135G possibly damaging Het
Cntn1 T A 15: 92,192,960 (GRCm39) N687K probably damaging Het
Col1a2 A T 6: 4,512,412 (GRCm39) M99L unknown Het
Cpeb2 T C 5: 43,391,235 (GRCm39) probably benign Het
Csn1s2b A G 5: 87,970,170 (GRCm39) T134A possibly damaging Het
Cst13 A T 2: 148,665,001 (GRCm39) probably benign Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
Dhx8 A G 11: 101,628,987 (GRCm39) S179G unknown Het
Dip2b A G 15: 100,049,241 (GRCm39) I212V probably benign Het
Dnah9 G A 11: 66,046,357 (GRCm39) H64Y probably benign Het
Dnal1 T C 12: 84,183,474 (GRCm39) probably benign Het
Dync2h1 T C 9: 7,051,411 (GRCm39) I3175V probably benign Het
Elf5 A G 2: 103,279,405 (GRCm39) N209D probably damaging Het
Elovl1 A G 4: 118,287,984 (GRCm39) Y40C probably damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
F5 G A 1: 164,001,755 (GRCm39) V153I probably benign Het
Fam186a G A 15: 99,842,413 (GRCm39) T1277I possibly damaging Het
Fam90a1a A T 8: 22,453,362 (GRCm39) H239L possibly damaging Het
Fchsd2 G T 7: 100,899,656 (GRCm39) R334L probably damaging Het
Fermt3 T C 19: 6,980,288 (GRCm39) Y369C probably damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnbp1l G T 3: 122,350,216 (GRCm39) Q332K probably benign Het
Frem3 T C 8: 81,390,049 (GRCm39) S1767P probably damaging Het
Ggt5 T C 10: 75,438,865 (GRCm39) L121P probably damaging Het
Gphn T C 12: 78,501,591 (GRCm39) S119P probably damaging Het
Herc2 A G 7: 55,781,001 (GRCm39) D1222G probably damaging Het
Hmx3 T C 7: 131,146,111 (GRCm39) I273T possibly damaging Het
Hnrnpu A G 1: 178,159,746 (GRCm39) probably benign Het
Hspg2 C T 4: 137,266,956 (GRCm39) T1987I possibly damaging Het
Ighv1-22 T A 12: 114,710,071 (GRCm39) Q58L probably damaging Het
Ighv14-3 T A 12: 114,023,875 (GRCm39) I7F probably benign Het
Kcns3 C A 12: 11,141,784 (GRCm39) R305L probably damaging Het
Kcnu1 C T 8: 26,400,949 (GRCm39) A699V possibly damaging Het
Kif22 A C 7: 126,632,500 (GRCm39) L270W probably damaging Het
Lrp2 G T 2: 69,319,642 (GRCm39) H1960Q probably benign Het
Marchf7 C T 2: 60,071,394 (GRCm39) Q94* probably null Het
Mcoln3 A T 3: 145,836,959 (GRCm39) I264F probably benign Het
Mdn1 A C 4: 32,679,572 (GRCm39) T706P probably damaging Het
Mfsd2b A G 12: 4,917,636 (GRCm39) C137R probably benign Het
Mmp25 A G 17: 23,863,581 (GRCm39) V83A probably benign Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Mtus2 T C 5: 148,235,070 (GRCm39) S1156P possibly damaging Het
Muc5b G A 7: 141,396,116 (GRCm39) R124H unknown Het
Mybbp1a G A 11: 72,338,797 (GRCm39) E775K possibly damaging Het
Myo10 A G 15: 25,793,239 (GRCm39) E1272G possibly damaging Het
Nars1 A G 18: 64,638,302 (GRCm39) S254P possibly damaging Het
Ncapd2 A G 6: 125,161,481 (GRCm39) I211T possibly damaging Het
Ncoa7 A T 10: 30,566,786 (GRCm39) W582R probably damaging Het
Npr3 T A 15: 11,905,553 (GRCm39) D58V possibly damaging Het
Nr3c1 G T 18: 39,561,780 (GRCm39) T430K probably benign Het
Odf2l A G 3: 144,833,801 (GRCm39) T111A probably benign Het
Ogdh G T 11: 6,290,600 (GRCm39) C406F probably benign Het
Olfml2a T G 2: 38,839,022 (GRCm39) S190A probably damaging Het
Optn T C 2: 5,037,950 (GRCm39) K415E probably benign Het
Or10n1 T C 9: 39,525,034 (GRCm39) M57T probably damaging Het
Or52a20 A G 7: 103,365,845 (GRCm39) T15A probably benign Het
Or8b12i T C 9: 20,082,394 (GRCm39) I158V probably benign Het
Or8g52 G T 9: 39,631,005 (GRCm39) V161F probably benign Het
Pakap A T 4: 57,855,655 (GRCm39) D328V possibly damaging Het
Perm1 C A 4: 156,304,663 (GRCm39) S803* probably null Het
Pex14 T C 4: 149,068,542 (GRCm39) T84A probably benign Het
Pih1d2 T A 9: 50,532,252 (GRCm39) Y103* probably null Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Polr1a A G 6: 71,894,805 (GRCm39) N171S probably benign Het
Prrx1 A G 1: 163,081,616 (GRCm39) S201P probably benign Het
Psme2b A T 11: 48,836,493 (GRCm39) N151K probably benign Het
Serpinb5 A T 1: 106,800,025 (GRCm39) T72S probably benign Het
Sgsm1 A G 5: 113,407,913 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,180,209 (GRCm39) R1063G possibly damaging Het
Slc19a3 T C 1: 83,000,520 (GRCm39) T166A probably benign Het
Slc5a4b T C 10: 75,910,879 (GRCm39) Y319C possibly damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Sult6b2 G T 6: 142,747,421 (GRCm39) C109* probably null Het
Tcf25 A G 8: 124,123,764 (GRCm39) E467G possibly damaging Het
Tmem177 A T 1: 119,837,950 (GRCm39) V243D probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Tspan11 T A 6: 127,920,678 (GRCm39) C208* probably null Het
Ttc1 A G 11: 43,636,144 (GRCm39) V33A probably benign Het
Tut4 G A 4: 108,352,356 (GRCm39) E357K probably damaging Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Utrn A C 10: 12,573,797 (GRCm39) V1091G probably benign Het
Vmn1r11 A T 6: 57,114,483 (GRCm39) H49L probably damaging Het
Vmn1r160 G T 7: 22,571,478 (GRCm39) S277I probably benign Het
Vmn1r18 A T 6: 57,367,069 (GRCm39) S162T probably benign Het
Vps37b A G 5: 124,148,795 (GRCm39) L80P probably damaging Het
Wfdc3 T C 2: 164,585,006 (GRCm39) M1V probably null Het
Wrn A T 8: 33,814,366 (GRCm39) N116K probably benign Het
Wscd2 G T 5: 113,715,333 (GRCm39) G391V probably damaging Het
Zfp286 A G 11: 62,671,428 (GRCm39) V215A probably benign Het
Zfp568 A G 7: 29,722,702 (GRCm39) H549R probably damaging Het
Other mutations in Dse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dse APN 10 34,038,801 (GRCm39) missense probably damaging 1.00
IGL01828:Dse APN 10 34,028,772 (GRCm39) missense probably damaging 0.97
IGL01835:Dse APN 10 34,036,213 (GRCm39) splice site probably benign
IGL01942:Dse APN 10 34,031,989 (GRCm39) missense probably benign 0.02
IGL02047:Dse APN 10 34,038,841 (GRCm39) nonsense probably null
IGL02208:Dse APN 10 34,028,433 (GRCm39) missense probably benign
IGL02306:Dse APN 10 34,036,130 (GRCm39) missense probably damaging 0.96
IGL02504:Dse APN 10 34,028,796 (GRCm39) missense probably benign
IGL02626:Dse APN 10 34,029,158 (GRCm39) missense probably damaging 0.99
IGL02812:Dse APN 10 34,059,712 (GRCm39) missense probably damaging 1.00
R0018:Dse UTSW 10 34,029,464 (GRCm39) missense probably benign 0.00
R0018:Dse UTSW 10 34,029,464 (GRCm39) missense probably benign 0.00
R0131:Dse UTSW 10 34,029,660 (GRCm39) missense probably damaging 1.00
R1300:Dse UTSW 10 34,028,411 (GRCm39) missense probably benign 0.00
R1502:Dse UTSW 10 34,029,214 (GRCm39) missense probably damaging 1.00
R1619:Dse UTSW 10 34,029,230 (GRCm39) missense probably damaging 1.00
R1736:Dse UTSW 10 34,029,145 (GRCm39) missense probably damaging 1.00
R1857:Dse UTSW 10 34,029,225 (GRCm39) missense probably benign 0.03
R1858:Dse UTSW 10 34,029,225 (GRCm39) missense probably benign 0.03
R1859:Dse UTSW 10 34,029,225 (GRCm39) missense probably benign 0.03
R1868:Dse UTSW 10 34,029,284 (GRCm39) missense possibly damaging 0.86
R1959:Dse UTSW 10 34,036,202 (GRCm39) missense probably damaging 1.00
R2082:Dse UTSW 10 34,031,936 (GRCm39) missense probably damaging 1.00
R2325:Dse UTSW 10 34,060,043 (GRCm39) missense probably benign 0.23
R2883:Dse UTSW 10 34,028,503 (GRCm39) missense probably benign 0.34
R3436:Dse UTSW 10 34,028,470 (GRCm39) missense probably benign
R3818:Dse UTSW 10 34,029,429 (GRCm39) missense probably benign
R4158:Dse UTSW 10 34,029,330 (GRCm39) missense probably damaging 1.00
R4159:Dse UTSW 10 34,029,330 (GRCm39) missense probably damaging 1.00
R4160:Dse UTSW 10 34,029,330 (GRCm39) missense probably damaging 1.00
R4229:Dse UTSW 10 34,038,740 (GRCm39) missense probably damaging 1.00
R4414:Dse UTSW 10 34,028,632 (GRCm39) missense probably benign 0.04
R4669:Dse UTSW 10 34,029,008 (GRCm39) missense probably damaging 1.00
R4777:Dse UTSW 10 34,029,584 (GRCm39) missense possibly damaging 0.56
R5154:Dse UTSW 10 34,029,657 (GRCm39) missense possibly damaging 0.83
R5573:Dse UTSW 10 34,028,678 (GRCm39) missense probably benign 0.02
R5804:Dse UTSW 10 34,029,375 (GRCm39) missense possibly damaging 0.84
R5844:Dse UTSW 10 34,029,038 (GRCm39) missense probably damaging 0.99
R5895:Dse UTSW 10 34,028,601 (GRCm39) missense probably damaging 1.00
R6290:Dse UTSW 10 34,028,336 (GRCm39) missense probably benign 0.00
R6600:Dse UTSW 10 34,028,537 (GRCm39) missense probably benign 0.06
R7088:Dse UTSW 10 34,029,885 (GRCm39) missense probably damaging 1.00
R7254:Dse UTSW 10 34,060,144 (GRCm39) start gained probably benign
R7491:Dse UTSW 10 34,028,561 (GRCm39) missense probably benign
R7989:Dse UTSW 10 34,029,454 (GRCm39) nonsense probably null
R8552:Dse UTSW 10 34,028,316 (GRCm39) missense possibly damaging 0.78
R8799:Dse UTSW 10 34,060,149 (GRCm39) start gained probably benign
R8862:Dse UTSW 10 34,029,934 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGACTCGAGATAGGATCTGC -3'
(R):5'- TCAGTGATGTATCCTCGGGG -3'

Sequencing Primer
(F):5'- CTCGAGATAGGATCTGCTTCTCAAG -3'
(R):5'- CAGTGATGTATCCTCGGGGTTATCC -3'
Posted On 2015-10-08