Incidental Mutation 'R4667:Cntn1'
ID 352083
Institutional Source Beutler Lab
Gene Symbol Cntn1
Ensembl Gene ENSMUSG00000055022
Gene Name contactin 1
Synonyms F3cam, usl, CNTN
MMRRC Submission 042012-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4667 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 91949034-92239834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 92192960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 687 (N687K)
Ref Sequence ENSEMBL: ENSMUSP00000133063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000109] [ENSMUST00000068378] [ENSMUST00000169825]
AlphaFold P12960
Predicted Effect probably damaging
Transcript: ENSMUST00000000109
AA Change: N687K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000109
Gene: ENSMUSG00000055022
AA Change: N687K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068378
AA Change: N687K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067842
Gene: ENSMUSG00000055022
AA Change: N687K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169825
AA Change: N687K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133063
Gene: ENSMUSG00000055022
AA Change: N687K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutations of this gene result in growth retardation, progressive ataxia and death prior to weaning. A targeted null mutation, but not a spontaneous mutation, causes a small cerebellum with abnormalities of the molecular layer and abnormal Purkinje cellaxon morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Adgra3 T A 5: 50,136,298 (GRCm39) Y729F possibly damaging Het
Ago2 A G 15: 73,018,265 (GRCm39) Y58H probably damaging Het
Akap13 A G 7: 75,378,842 (GRCm39) T2128A probably damaging Het
Ankhd1 C A 18: 36,781,074 (GRCm39) P2042Q possibly damaging Het
Arhgef15 T C 11: 68,845,387 (GRCm39) K155R probably benign Het
Atp10b T C 11: 43,138,345 (GRCm39) F1209L probably damaging Het
B130006D01Rik A T 11: 95,617,335 (GRCm39) probably benign Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Bnip5 G T 17: 29,127,287 (GRCm39) Q241K possibly damaging Het
Btbd17 A G 11: 114,684,683 (GRCm39) F119L possibly damaging Het
Ccdc191 G T 16: 43,751,646 (GRCm39) K267N probably damaging Het
Cd200l1 A G 16: 45,264,526 (GRCm39) S11P probably benign Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Cemip2 G A 19: 21,774,715 (GRCm39) R119H probably benign Het
Cemip2 C T 19: 21,822,145 (GRCm39) A1180V probably benign Het
Chd9 T C 8: 91,760,428 (GRCm39) S2058P possibly damaging Het
Clcn6 T C 4: 148,108,624 (GRCm39) E135G possibly damaging Het
Col1a2 A T 6: 4,512,412 (GRCm39) M99L unknown Het
Cpeb2 T C 5: 43,391,235 (GRCm39) probably benign Het
Csn1s2b A G 5: 87,970,170 (GRCm39) T134A possibly damaging Het
Cst13 A T 2: 148,665,001 (GRCm39) probably benign Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
Dhx8 A G 11: 101,628,987 (GRCm39) S179G unknown Het
Dip2b A G 15: 100,049,241 (GRCm39) I212V probably benign Het
Dnah9 G A 11: 66,046,357 (GRCm39) H64Y probably benign Het
Dnal1 T C 12: 84,183,474 (GRCm39) probably benign Het
Dse T G 10: 34,029,008 (GRCm39) Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 (GRCm39) I3175V probably benign Het
Elf5 A G 2: 103,279,405 (GRCm39) N209D probably damaging Het
Elovl1 A G 4: 118,287,984 (GRCm39) Y40C probably damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
F5 G A 1: 164,001,755 (GRCm39) V153I probably benign Het
Fam186a G A 15: 99,842,413 (GRCm39) T1277I possibly damaging Het
Fam90a1a A T 8: 22,453,362 (GRCm39) H239L possibly damaging Het
Fchsd2 G T 7: 100,899,656 (GRCm39) R334L probably damaging Het
Fermt3 T C 19: 6,980,288 (GRCm39) Y369C probably damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnbp1l G T 3: 122,350,216 (GRCm39) Q332K probably benign Het
Frem3 T C 8: 81,390,049 (GRCm39) S1767P probably damaging Het
Ggt5 T C 10: 75,438,865 (GRCm39) L121P probably damaging Het
Gphn T C 12: 78,501,591 (GRCm39) S119P probably damaging Het
Herc2 A G 7: 55,781,001 (GRCm39) D1222G probably damaging Het
Hmx3 T C 7: 131,146,111 (GRCm39) I273T possibly damaging Het
Hnrnpu A G 1: 178,159,746 (GRCm39) probably benign Het
Hspg2 C T 4: 137,266,956 (GRCm39) T1987I possibly damaging Het
Ighv1-22 T A 12: 114,710,071 (GRCm39) Q58L probably damaging Het
Ighv14-3 T A 12: 114,023,875 (GRCm39) I7F probably benign Het
Kcns3 C A 12: 11,141,784 (GRCm39) R305L probably damaging Het
Kcnu1 C T 8: 26,400,949 (GRCm39) A699V possibly damaging Het
Kif22 A C 7: 126,632,500 (GRCm39) L270W probably damaging Het
Lrp2 G T 2: 69,319,642 (GRCm39) H1960Q probably benign Het
Marchf7 C T 2: 60,071,394 (GRCm39) Q94* probably null Het
Mcoln3 A T 3: 145,836,959 (GRCm39) I264F probably benign Het
Mdn1 A C 4: 32,679,572 (GRCm39) T706P probably damaging Het
Mfsd2b A G 12: 4,917,636 (GRCm39) C137R probably benign Het
Mmp25 A G 17: 23,863,581 (GRCm39) V83A probably benign Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Mtus2 T C 5: 148,235,070 (GRCm39) S1156P possibly damaging Het
Muc5b G A 7: 141,396,116 (GRCm39) R124H unknown Het
Mybbp1a G A 11: 72,338,797 (GRCm39) E775K possibly damaging Het
Myo10 A G 15: 25,793,239 (GRCm39) E1272G possibly damaging Het
Nars1 A G 18: 64,638,302 (GRCm39) S254P possibly damaging Het
Ncapd2 A G 6: 125,161,481 (GRCm39) I211T possibly damaging Het
Ncoa7 A T 10: 30,566,786 (GRCm39) W582R probably damaging Het
Npr3 T A 15: 11,905,553 (GRCm39) D58V possibly damaging Het
Nr3c1 G T 18: 39,561,780 (GRCm39) T430K probably benign Het
Odf2l A G 3: 144,833,801 (GRCm39) T111A probably benign Het
Ogdh G T 11: 6,290,600 (GRCm39) C406F probably benign Het
Olfml2a T G 2: 38,839,022 (GRCm39) S190A probably damaging Het
Optn T C 2: 5,037,950 (GRCm39) K415E probably benign Het
Or10n1 T C 9: 39,525,034 (GRCm39) M57T probably damaging Het
Or52a20 A G 7: 103,365,845 (GRCm39) T15A probably benign Het
Or8b12i T C 9: 20,082,394 (GRCm39) I158V probably benign Het
Or8g52 G T 9: 39,631,005 (GRCm39) V161F probably benign Het
Pakap A T 4: 57,855,655 (GRCm39) D328V possibly damaging Het
Perm1 C A 4: 156,304,663 (GRCm39) S803* probably null Het
Pex14 T C 4: 149,068,542 (GRCm39) T84A probably benign Het
Pih1d2 T A 9: 50,532,252 (GRCm39) Y103* probably null Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Polr1a A G 6: 71,894,805 (GRCm39) N171S probably benign Het
Prrx1 A G 1: 163,081,616 (GRCm39) S201P probably benign Het
Psme2b A T 11: 48,836,493 (GRCm39) N151K probably benign Het
Serpinb5 A T 1: 106,800,025 (GRCm39) T72S probably benign Het
Sgsm1 A G 5: 113,407,913 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,180,209 (GRCm39) R1063G possibly damaging Het
Slc19a3 T C 1: 83,000,520 (GRCm39) T166A probably benign Het
Slc5a4b T C 10: 75,910,879 (GRCm39) Y319C possibly damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Sult6b2 G T 6: 142,747,421 (GRCm39) C109* probably null Het
Tcf25 A G 8: 124,123,764 (GRCm39) E467G possibly damaging Het
Tmem177 A T 1: 119,837,950 (GRCm39) V243D probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Tspan11 T A 6: 127,920,678 (GRCm39) C208* probably null Het
Ttc1 A G 11: 43,636,144 (GRCm39) V33A probably benign Het
Tut4 G A 4: 108,352,356 (GRCm39) E357K probably damaging Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Utrn A C 10: 12,573,797 (GRCm39) V1091G probably benign Het
Vmn1r11 A T 6: 57,114,483 (GRCm39) H49L probably damaging Het
Vmn1r160 G T 7: 22,571,478 (GRCm39) S277I probably benign Het
Vmn1r18 A T 6: 57,367,069 (GRCm39) S162T probably benign Het
Vps37b A G 5: 124,148,795 (GRCm39) L80P probably damaging Het
Wfdc3 T C 2: 164,585,006 (GRCm39) M1V probably null Het
Wrn A T 8: 33,814,366 (GRCm39) N116K probably benign Het
Wscd2 G T 5: 113,715,333 (GRCm39) G391V probably damaging Het
Zfp286 A G 11: 62,671,428 (GRCm39) V215A probably benign Het
Zfp568 A G 7: 29,722,702 (GRCm39) H549R probably damaging Het
Other mutations in Cntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cntn1 APN 15 92,148,758 (GRCm39) missense possibly damaging 0.92
IGL01109:Cntn1 APN 15 92,237,458 (GRCm39) nonsense probably null
IGL01399:Cntn1 APN 15 92,203,025 (GRCm39) missense probably damaging 1.00
IGL01714:Cntn1 APN 15 92,151,870 (GRCm39) nonsense probably null
IGL02052:Cntn1 APN 15 92,189,584 (GRCm39) missense possibly damaging 0.95
IGL02342:Cntn1 APN 15 92,143,898 (GRCm39) missense probably benign 0.01
IGL02507:Cntn1 APN 15 92,148,860 (GRCm39) missense possibly damaging 0.92
IGL02511:Cntn1 APN 15 92,114,266 (GRCm39) start gained probably benign
IGL02702:Cntn1 APN 15 92,189,482 (GRCm39) splice site probably benign
IGL02927:Cntn1 APN 15 92,189,561 (GRCm39) missense probably benign 0.12
IGL02948:Cntn1 APN 15 92,143,891 (GRCm39) missense probably benign 0.01
R0035:Cntn1 UTSW 15 92,129,969 (GRCm39) splice site probably benign
R0084:Cntn1 UTSW 15 92,215,798 (GRCm39) missense probably benign 0.01
R0346:Cntn1 UTSW 15 92,129,968 (GRCm39) splice site probably benign
R0634:Cntn1 UTSW 15 92,212,444 (GRCm39) nonsense probably null
R1348:Cntn1 UTSW 15 92,212,544 (GRCm39) missense probably damaging 1.00
R1613:Cntn1 UTSW 15 92,143,871 (GRCm39) missense possibly damaging 0.60
R1793:Cntn1 UTSW 15 92,189,552 (GRCm39) missense possibly damaging 0.92
R1815:Cntn1 UTSW 15 92,148,829 (GRCm39) missense probably benign 0.00
R1851:Cntn1 UTSW 15 92,203,021 (GRCm39) missense probably damaging 1.00
R1852:Cntn1 UTSW 15 92,203,021 (GRCm39) missense probably damaging 1.00
R2068:Cntn1 UTSW 15 92,215,943 (GRCm39) missense possibly damaging 0.82
R2269:Cntn1 UTSW 15 92,192,863 (GRCm39) splice site probably benign
R4394:Cntn1 UTSW 15 92,189,645 (GRCm39) missense probably damaging 1.00
R4771:Cntn1 UTSW 15 92,202,972 (GRCm39) missense possibly damaging 0.82
R4944:Cntn1 UTSW 15 92,126,549 (GRCm39) missense probably damaging 1.00
R5044:Cntn1 UTSW 15 92,140,876 (GRCm39) missense probably damaging 1.00
R5218:Cntn1 UTSW 15 92,237,430 (GRCm39) missense unknown
R5314:Cntn1 UTSW 15 92,192,892 (GRCm39) missense probably benign 0.01
R5445:Cntn1 UTSW 15 92,192,958 (GRCm39) missense probably damaging 1.00
R5518:Cntn1 UTSW 15 92,212,534 (GRCm39) missense probably benign 0.00
R6849:Cntn1 UTSW 15 92,203,127 (GRCm39) missense probably damaging 0.99
R6885:Cntn1 UTSW 15 92,140,980 (GRCm39) critical splice donor site probably null
R7035:Cntn1 UTSW 15 92,212,392 (GRCm39) missense probably benign 0.04
R7070:Cntn1 UTSW 15 92,151,917 (GRCm39) missense probably damaging 1.00
R7287:Cntn1 UTSW 15 92,143,833 (GRCm39) splice site probably null
R7311:Cntn1 UTSW 15 92,130,156 (GRCm39) critical splice donor site probably null
R7401:Cntn1 UTSW 15 92,215,870 (GRCm39) missense probably benign
R7484:Cntn1 UTSW 15 92,151,922 (GRCm39) missense probably benign 0.00
R7492:Cntn1 UTSW 15 92,212,423 (GRCm39) missense probably benign
R7617:Cntn1 UTSW 15 92,143,970 (GRCm39) missense probably damaging 1.00
R7644:Cntn1 UTSW 15 92,207,890 (GRCm39) missense probably benign 0.14
R7878:Cntn1 UTSW 15 92,192,934 (GRCm39) missense probably damaging 1.00
R8354:Cntn1 UTSW 15 92,130,130 (GRCm39) missense probably benign
R8454:Cntn1 UTSW 15 92,130,130 (GRCm39) missense probably benign
R8465:Cntn1 UTSW 15 92,237,404 (GRCm39) frame shift probably null
R8757:Cntn1 UTSW 15 92,153,801 (GRCm39) missense possibly damaging 0.90
R8759:Cntn1 UTSW 15 92,153,801 (GRCm39) missense possibly damaging 0.90
R8767:Cntn1 UTSW 15 92,132,347 (GRCm39) missense probably damaging 1.00
R8768:Cntn1 UTSW 15 92,132,347 (GRCm39) missense probably damaging 1.00
R8885:Cntn1 UTSW 15 92,159,380 (GRCm39) missense probably benign 0.00
R8972:Cntn1 UTSW 15 92,150,278 (GRCm39) missense probably benign 0.18
R8993:Cntn1 UTSW 15 92,132,347 (GRCm39) missense probably damaging 1.00
R8995:Cntn1 UTSW 15 92,132,347 (GRCm39) missense probably damaging 1.00
R8997:Cntn1 UTSW 15 92,132,347 (GRCm39) missense probably damaging 1.00
R9151:Cntn1 UTSW 15 92,140,864 (GRCm39) missense probably damaging 1.00
R9438:Cntn1 UTSW 15 92,144,024 (GRCm39) critical splice donor site probably null
R9493:Cntn1 UTSW 15 92,189,644 (GRCm39) missense probably damaging 1.00
Z1177:Cntn1 UTSW 15 92,207,851 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAACCCAGAATACATGTGCC -3'
(R):5'- ACATAGTCTCTGGTGTAATGTGC -3'

Sequencing Primer
(F):5'- GAATACATGTGCCAACTCTCTAAG -3'
(R):5'- GGTTGTTTTTGGCTACACACAC -3'
Posted On 2015-10-08