Incidental Mutation 'R4667:Fhod3'
ID352093
Institutional Source Beutler Lab
Gene Symbol Fhod3
Ensembl Gene ENSMUSG00000034295
Gene Nameformin homology 2 domain containing 3
SynonymsA930009H06Rik
MMRRC Submission 042012-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4667 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location24709445-25133500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25066338 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 689 (P689S)
Ref Sequence ENSEMBL: ENSMUSP00000041361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097]
Predicted Effect probably benign
Transcript: ENSMUST00000037097
AA Change: P689S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295
AA Change: P689S

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the diaphanous-related formins (DRF), and contains multiple domains, including GBD (GTPase-binding domain), DID (diaphanous inhibitory domain), FH1 (formin homology 1), FH2 (formin homology 2), and DAD (diaphanous auto-regulatory domain) domains. This protein is thought to play a role in actin filament polymerization in cardiomyocytes. Mutations in this gene have been associated with dilated cardiomyopathy (DCM), characterized by dilation of the ventricular chamber, leading to impairment of systolic pump function and subsequent heart failure. Increased levels of the protein encoded by this gene have been observed in individuals with hypertrophic cardiomyopathy (HCM). Alternative splicing results in multiple transcript variants encoding different isoforms. A muscle-specific isoform has been shown to possess a casein kinase 2 (CK2) phosphorylation site at the C-terminal end of the FH2 domain. Phosphorylation of this site alters its interaction with sequestosome 1 (SQSTM1), and targets this isoform to myofibrils, while other isoforms form cytoplasmic aggregates. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out reporter allele exhibit abnormal premyofibril maturation, impaired heart development, pericardial effusion and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G T 17: 28,908,313 Q241K possibly damaging Het
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Adgra3 T A 5: 49,978,956 Y729F possibly damaging Het
Ago2 A G 15: 73,146,416 Y58H probably damaging Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Akap2 A T 4: 57,855,655 D328V possibly damaging Het
Ankhd1 C A 18: 36,648,021 P2042Q possibly damaging Het
Arhgef15 T C 11: 68,954,561 K155R probably benign Het
Atp10b T C 11: 43,247,518 F1209L probably damaging Het
B130006D01Rik A T 11: 95,726,509 probably benign Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Btbd17 A G 11: 114,793,857 F119L possibly damaging Het
Ccdc191 G T 16: 43,931,283 K267N probably damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Chd9 T C 8: 91,033,800 S2058P possibly damaging Het
Clcn6 T C 4: 148,024,167 E135G possibly damaging Het
Cntn1 T A 15: 92,295,079 N687K probably damaging Het
Col1a2 A T 6: 4,512,412 M99L unknown Het
Cpeb2 T C 5: 43,233,892 probably benign Het
Csn1s2b A G 5: 87,822,311 T134A possibly damaging Het
Cst13 A T 2: 148,823,081 probably benign Het
Cyp2c66 T A 19: 39,176,656 D360E probably damaging Het
Dhx8 A G 11: 101,738,161 S179G unknown Het
Dip2b A G 15: 100,151,360 I212V probably benign Het
Dnah9 G A 11: 66,155,531 H64Y probably benign Het
Dnal1 T C 12: 84,136,700 probably benign Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 I3175V probably benign Het
Elf5 A G 2: 103,449,060 N209D probably damaging Het
Elovl1 A G 4: 118,430,787 Y40C probably damaging Het
Erp27 T C 6: 136,908,152 E216G possibly damaging Het
F5 G A 1: 164,174,186 V153I probably benign Het
Fam186a G A 15: 99,944,532 T1277I possibly damaging Het
Fam90a1a A T 8: 21,963,346 H239L possibly damaging Het
Fchsd2 G T 7: 101,250,449 R334L probably damaging Het
Fermt3 T C 19: 7,002,920 Y369C probably damaging Het
Fnbp1l G T 3: 122,556,567 Q332K probably benign Het
Frem3 T C 8: 80,663,420 S1767P probably damaging Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gm609 A G 16: 45,444,163 S11P probably benign Het
Gphn T C 12: 78,454,817 S119P probably damaging Het
Herc2 A G 7: 56,131,253 D1222G probably damaging Het
Hmx3 T C 7: 131,544,382 I273T possibly damaging Het
Hnrnpu A G 1: 178,332,181 probably benign Het
Hspg2 C T 4: 137,539,645 T1987I possibly damaging Het
Ighv1-22 T A 12: 114,746,451 Q58L probably damaging Het
Ighv14-3 T A 12: 114,060,255 I7F probably benign Het
Kcns3 C A 12: 11,091,783 R305L probably damaging Het
Kcnu1 C T 8: 25,910,921 A699V possibly damaging Het
Kif22 A C 7: 127,033,328 L270W probably damaging Het
Lrp2 G T 2: 69,489,298 H1960Q probably benign Het
March7 C T 2: 60,241,050 Q94* probably null Het
Mcoln3 A T 3: 146,131,204 I264F probably benign Het
Mdn1 A C 4: 32,679,572 T706P probably damaging Het
Mfsd2b A G 12: 4,867,636 C137R probably benign Het
Mmp25 A G 17: 23,644,607 V83A probably benign Het
Mocos T C 18: 24,666,434 Y242H probably benign Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtus2 T C 5: 148,298,260 S1156P possibly damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mybbp1a G A 11: 72,447,971 E775K possibly damaging Het
Myo10 A G 15: 25,793,153 E1272G possibly damaging Het
Nars A G 18: 64,505,231 S254P possibly damaging Het
Ncapd2 A G 6: 125,184,518 I211T possibly damaging Het
Ncoa7 A T 10: 30,690,790 W582R probably damaging Het
Npr3 T A 15: 11,905,467 D58V possibly damaging Het
Nr3c1 G T 18: 39,428,727 T430K probably benign Het
Odf2l A G 3: 145,128,040 T111A probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfml2a T G 2: 38,949,010 S190A probably damaging Het
Olfr148 T C 9: 39,613,738 M57T probably damaging Het
Olfr243 A G 7: 103,716,638 T15A probably benign Het
Olfr870 T C 9: 20,171,098 I158V probably benign Het
Olfr965 G T 9: 39,719,709 V161F probably benign Het
Optn T C 2: 5,033,139 K415E probably benign Het
Perm1 C A 4: 156,220,206 S803* probably null Het
Pex14 T C 4: 148,984,085 T84A probably benign Het
Pih1d2 T A 9: 50,620,952 Y103* probably null Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Polr1a A G 6: 71,917,821 N171S probably benign Het
Prrx1 A G 1: 163,254,047 S201P probably benign Het
Psme2b A T 11: 48,945,666 N151K probably benign Het
Serpinb5 A T 1: 106,872,295 T72S probably benign Het
Sgsm1 A G 5: 113,260,047 probably null Het
Sipa1l2 T C 8: 125,453,470 R1063G possibly damaging Het
Slc19a3 T C 1: 83,022,799 T166A probably benign Het
Slc5a4b T C 10: 76,075,045 Y319C possibly damaging Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Sult6b2 G T 6: 142,801,695 C109* probably null Het
Tcf25 A G 8: 123,397,025 E467G possibly damaging Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Tmem2 G A 19: 21,797,351 R119H probably benign Het
Tmem2 C T 19: 21,844,781 A1180V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tspan11 T A 6: 127,943,715 C208* probably null Het
Ttc1 A G 11: 43,745,317 V33A probably benign Het
Uck1 T A 2: 32,256,034 H283L probably damaging Het
Utrn A C 10: 12,698,053 V1091G probably benign Het
Vmn1r11 A T 6: 57,137,498 H49L probably damaging Het
Vmn1r160 G T 7: 22,872,053 S277I probably benign Het
Vmn1r18 A T 6: 57,390,084 S162T probably benign Het
Vps37b A G 5: 124,010,732 L80P probably damaging Het
Wfdc3 T C 2: 164,743,086 M1V probably null Het
Wrn A T 8: 33,324,338 N116K probably benign Het
Wscd2 G T 5: 113,577,272 G391V probably damaging Het
Zcchc11 G A 4: 108,495,159 E357K probably damaging Het
Zfp286 A G 11: 62,780,602 V215A probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Other mutations in Fhod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Fhod3 APN 18 24994540 missense probably damaging 1.00
IGL01139:Fhod3 APN 18 25066344 missense probably benign 0.00
IGL01293:Fhod3 APN 18 25020652 splice site probably benign
IGL01313:Fhod3 APN 18 25020720 missense probably damaging 1.00
IGL01524:Fhod3 APN 18 25130602 missense probably damaging 0.99
IGL01568:Fhod3 APN 18 25120162 missense probably benign 0.04
IGL01586:Fhod3 APN 18 25090747 missense probably damaging 0.98
IGL01622:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01623:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01640:Fhod3 APN 18 25115793 missense probably benign 0.13
IGL01860:Fhod3 APN 18 24897681 missense probably damaging 0.99
IGL01860:Fhod3 APN 18 24903948 missense probably damaging 1.00
IGL02192:Fhod3 APN 18 25056358 missense probably damaging 1.00
IGL02390:Fhod3 APN 18 25066275 missense probably benign 0.15
IGL02550:Fhod3 APN 18 25022960 missense probably benign 0.00
IGL02987:Fhod3 APN 18 25113553 missense possibly damaging 0.87
R0328:Fhod3 UTSW 18 25113600 missense probably benign 0.01
R0362:Fhod3 UTSW 18 25090076 nonsense probably null
R0373:Fhod3 UTSW 18 25090104 missense possibly damaging 0.93
R0483:Fhod3 UTSW 18 24709616 missense probably damaging 1.00
R0570:Fhod3 UTSW 18 25112583 missense probably benign 0.27
R0617:Fhod3 UTSW 18 25112679 splice site probably benign
R0834:Fhod3 UTSW 18 25115805 nonsense probably null
R0836:Fhod3 UTSW 18 25066218 missense probably damaging 1.00
R1132:Fhod3 UTSW 18 25020665 small deletion probably benign
R1157:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1158:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1160:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1381:Fhod3 UTSW 18 25090471 missense probably damaging 1.00
R1533:Fhod3 UTSW 18 25115864 missense probably damaging 1.00
R1621:Fhod3 UTSW 18 25022867 missense probably benign 0.35
R1748:Fhod3 UTSW 18 24770493 nonsense probably null
R1757:Fhod3 UTSW 18 25066278 missense possibly damaging 0.78
R1758:Fhod3 UTSW 18 25120310 missense possibly damaging 0.88
R1872:Fhod3 UTSW 18 25130610 missense probably damaging 1.00
R1911:Fhod3 UTSW 18 25112586 missense possibly damaging 0.81
R1917:Fhod3 UTSW 18 24989965 splice site probably benign
R1917:Fhod3 UTSW 18 25085601 missense probably benign 0.27
R1934:Fhod3 UTSW 18 25090278 missense probably benign 0.35
R1958:Fhod3 UTSW 18 25090465 missense probably damaging 1.00
R1997:Fhod3 UTSW 18 25090416 missense possibly damaging 0.79
R3618:Fhod3 UTSW 18 25020665 small deletion probably benign
R3709:Fhod3 UTSW 18 25090758 missense probably damaging 1.00
R3937:Fhod3 UTSW 18 25090761 missense probably benign 0.44
R4246:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4248:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4249:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4497:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4498:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4532:Fhod3 UTSW 18 25110221 missense probably damaging 1.00
R4596:Fhod3 UTSW 18 25115718 missense probably benign 0.01
R4628:Fhod3 UTSW 18 25120129 missense possibly damaging 0.94
R4668:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4734:Fhod3 UTSW 18 25028135 missense probably benign 0.00
R4753:Fhod3 UTSW 18 25090325 missense possibly damaging 0.80
R4796:Fhod3 UTSW 18 24985301 missense probably damaging 1.00
R4832:Fhod3 UTSW 18 25090248 missense probably benign 0.00
R5338:Fhod3 UTSW 18 25028081 missense probably damaging 0.96
R5832:Fhod3 UTSW 18 25090695 missense probably damaging 1.00
R5863:Fhod3 UTSW 18 25125753 missense probably benign 0.25
R6362:Fhod3 UTSW 18 24754255 missense probably benign 0.00
R6414:Fhod3 UTSW 18 25090878 missense possibly damaging 0.64
R7099:Fhod3 UTSW 18 25090162 missense probably benign
R7172:Fhod3 UTSW 18 25085546 missense probably damaging 1.00
R7190:Fhod3 UTSW 18 25090755 missense probably damaging 1.00
R7241:Fhod3 UTSW 18 25060352 missense probably damaging 1.00
R7294:Fhod3 UTSW 18 25132980 missense probably damaging 1.00
R7348:Fhod3 UTSW 18 25090467 missense possibly damaging 0.80
R7432:Fhod3 UTSW 18 25001909 missense possibly damaging 0.95
R7588:Fhod3 UTSW 18 25090248 missense probably benign 0.02
R7629:Fhod3 UTSW 18 24754317 missense probably benign 0.08
R7667:Fhod3 UTSW 18 25001944 missense probably benign
R7681:Fhod3 UTSW 18 24990038 missense probably damaging 1.00
R7829:Fhod3 UTSW 18 25115890 critical splice donor site probably null
R7889:Fhod3 UTSW 18 24770494 missense probably damaging 0.99
R7972:Fhod3 UTSW 18 24770494 missense probably damaging 0.99
R8072:Fhod3 UTSW 18 25020665 small deletion probably benign
Z1177:Fhod3 UTSW 18 25020706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCACTCTGCAGGTGTTC -3'
(R):5'- GAAACTTACCTGTCCTGATGTCTC -3'

Sequencing Primer
(F):5'- TGCAGGTGTTCCATCCATAAAC -3'
(R):5'- CTCAGGTCAGCTTGTAGGC -3'
Posted On2015-10-08