Incidental Mutation 'R4667:Cemip2'
ID 352099
Institutional Source Beutler Lab
Gene Symbol Cemip2
Ensembl Gene ENSMUSG00000024754
Gene Name cell migration inducing hyaluronidase 2
Synonyms 3110012M15Rik, Tmem2
MMRRC Submission 042012-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R4667 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 21755706-21835724 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 21822145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1180 (A1180V)
Ref Sequence ENSEMBL: ENSMUSP00000093908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025663] [ENSMUST00000096194]
AlphaFold Q5FWI3
Predicted Effect probably benign
Transcript: ENSMUST00000025663
AA Change: A1180V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025663
Gene: ENSMUSG00000024754
AA Change: A1180V

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Pfam:ILEI 265 360 2.1e-24 PFAM
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Pfam:ILEI 1243 1333 9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096194
AA Change: A1180V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093908
Gene: ENSMUSG00000024754
AA Change: A1180V

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Adgra3 T A 5: 50,136,298 (GRCm39) Y729F possibly damaging Het
Ago2 A G 15: 73,018,265 (GRCm39) Y58H probably damaging Het
Akap13 A G 7: 75,378,842 (GRCm39) T2128A probably damaging Het
Ankhd1 C A 18: 36,781,074 (GRCm39) P2042Q possibly damaging Het
Arhgef15 T C 11: 68,845,387 (GRCm39) K155R probably benign Het
Atp10b T C 11: 43,138,345 (GRCm39) F1209L probably damaging Het
B130006D01Rik A T 11: 95,617,335 (GRCm39) probably benign Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Bnip5 G T 17: 29,127,287 (GRCm39) Q241K possibly damaging Het
Btbd17 A G 11: 114,684,683 (GRCm39) F119L possibly damaging Het
Ccdc191 G T 16: 43,751,646 (GRCm39) K267N probably damaging Het
Cd200l1 A G 16: 45,264,526 (GRCm39) S11P probably benign Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Chd9 T C 8: 91,760,428 (GRCm39) S2058P possibly damaging Het
Clcn6 T C 4: 148,108,624 (GRCm39) E135G possibly damaging Het
Cntn1 T A 15: 92,192,960 (GRCm39) N687K probably damaging Het
Col1a2 A T 6: 4,512,412 (GRCm39) M99L unknown Het
Cpeb2 T C 5: 43,391,235 (GRCm39) probably benign Het
Csn1s2b A G 5: 87,970,170 (GRCm39) T134A possibly damaging Het
Cst13 A T 2: 148,665,001 (GRCm39) probably benign Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
Dhx8 A G 11: 101,628,987 (GRCm39) S179G unknown Het
Dip2b A G 15: 100,049,241 (GRCm39) I212V probably benign Het
Dnah9 G A 11: 66,046,357 (GRCm39) H64Y probably benign Het
Dnal1 T C 12: 84,183,474 (GRCm39) probably benign Het
Dse T G 10: 34,029,008 (GRCm39) Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 (GRCm39) I3175V probably benign Het
Elf5 A G 2: 103,279,405 (GRCm39) N209D probably damaging Het
Elovl1 A G 4: 118,287,984 (GRCm39) Y40C probably damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
F5 G A 1: 164,001,755 (GRCm39) V153I probably benign Het
Fam186a G A 15: 99,842,413 (GRCm39) T1277I possibly damaging Het
Fam90a1a A T 8: 22,453,362 (GRCm39) H239L possibly damaging Het
Fchsd2 G T 7: 100,899,656 (GRCm39) R334L probably damaging Het
Fermt3 T C 19: 6,980,288 (GRCm39) Y369C probably damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnbp1l G T 3: 122,350,216 (GRCm39) Q332K probably benign Het
Frem3 T C 8: 81,390,049 (GRCm39) S1767P probably damaging Het
Ggt5 T C 10: 75,438,865 (GRCm39) L121P probably damaging Het
Gphn T C 12: 78,501,591 (GRCm39) S119P probably damaging Het
Herc2 A G 7: 55,781,001 (GRCm39) D1222G probably damaging Het
Hmx3 T C 7: 131,146,111 (GRCm39) I273T possibly damaging Het
Hnrnpu A G 1: 178,159,746 (GRCm39) probably benign Het
Hspg2 C T 4: 137,266,956 (GRCm39) T1987I possibly damaging Het
Ighv1-22 T A 12: 114,710,071 (GRCm39) Q58L probably damaging Het
Ighv14-3 T A 12: 114,023,875 (GRCm39) I7F probably benign Het
Kcns3 C A 12: 11,141,784 (GRCm39) R305L probably damaging Het
Kcnu1 C T 8: 26,400,949 (GRCm39) A699V possibly damaging Het
Kif22 A C 7: 126,632,500 (GRCm39) L270W probably damaging Het
Lrp2 G T 2: 69,319,642 (GRCm39) H1960Q probably benign Het
Marchf7 C T 2: 60,071,394 (GRCm39) Q94* probably null Het
Mcoln3 A T 3: 145,836,959 (GRCm39) I264F probably benign Het
Mdn1 A C 4: 32,679,572 (GRCm39) T706P probably damaging Het
Mfsd2b A G 12: 4,917,636 (GRCm39) C137R probably benign Het
Mmp25 A G 17: 23,863,581 (GRCm39) V83A probably benign Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Mtus2 T C 5: 148,235,070 (GRCm39) S1156P possibly damaging Het
Muc5b G A 7: 141,396,116 (GRCm39) R124H unknown Het
Mybbp1a G A 11: 72,338,797 (GRCm39) E775K possibly damaging Het
Myo10 A G 15: 25,793,239 (GRCm39) E1272G possibly damaging Het
Nars1 A G 18: 64,638,302 (GRCm39) S254P possibly damaging Het
Ncapd2 A G 6: 125,161,481 (GRCm39) I211T possibly damaging Het
Ncoa7 A T 10: 30,566,786 (GRCm39) W582R probably damaging Het
Npr3 T A 15: 11,905,553 (GRCm39) D58V possibly damaging Het
Nr3c1 G T 18: 39,561,780 (GRCm39) T430K probably benign Het
Odf2l A G 3: 144,833,801 (GRCm39) T111A probably benign Het
Ogdh G T 11: 6,290,600 (GRCm39) C406F probably benign Het
Olfml2a T G 2: 38,839,022 (GRCm39) S190A probably damaging Het
Optn T C 2: 5,037,950 (GRCm39) K415E probably benign Het
Or10n1 T C 9: 39,525,034 (GRCm39) M57T probably damaging Het
Or52a20 A G 7: 103,365,845 (GRCm39) T15A probably benign Het
Or8b12i T C 9: 20,082,394 (GRCm39) I158V probably benign Het
Or8g52 G T 9: 39,631,005 (GRCm39) V161F probably benign Het
Pakap A T 4: 57,855,655 (GRCm39) D328V possibly damaging Het
Perm1 C A 4: 156,304,663 (GRCm39) S803* probably null Het
Pex14 T C 4: 149,068,542 (GRCm39) T84A probably benign Het
Pih1d2 T A 9: 50,532,252 (GRCm39) Y103* probably null Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Polr1a A G 6: 71,894,805 (GRCm39) N171S probably benign Het
Prrx1 A G 1: 163,081,616 (GRCm39) S201P probably benign Het
Psme2b A T 11: 48,836,493 (GRCm39) N151K probably benign Het
Serpinb5 A T 1: 106,800,025 (GRCm39) T72S probably benign Het
Sgsm1 A G 5: 113,407,913 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,180,209 (GRCm39) R1063G possibly damaging Het
Slc19a3 T C 1: 83,000,520 (GRCm39) T166A probably benign Het
Slc5a4b T C 10: 75,910,879 (GRCm39) Y319C possibly damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Sult6b2 G T 6: 142,747,421 (GRCm39) C109* probably null Het
Tcf25 A G 8: 124,123,764 (GRCm39) E467G possibly damaging Het
Tmem177 A T 1: 119,837,950 (GRCm39) V243D probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Tspan11 T A 6: 127,920,678 (GRCm39) C208* probably null Het
Ttc1 A G 11: 43,636,144 (GRCm39) V33A probably benign Het
Tut4 G A 4: 108,352,356 (GRCm39) E357K probably damaging Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Utrn A C 10: 12,573,797 (GRCm39) V1091G probably benign Het
Vmn1r11 A T 6: 57,114,483 (GRCm39) H49L probably damaging Het
Vmn1r160 G T 7: 22,571,478 (GRCm39) S277I probably benign Het
Vmn1r18 A T 6: 57,367,069 (GRCm39) S162T probably benign Het
Vps37b A G 5: 124,148,795 (GRCm39) L80P probably damaging Het
Wfdc3 T C 2: 164,585,006 (GRCm39) M1V probably null Het
Wrn A T 8: 33,814,366 (GRCm39) N116K probably benign Het
Wscd2 G T 5: 113,715,333 (GRCm39) G391V probably damaging Het
Zfp286 A G 11: 62,671,428 (GRCm39) V215A probably benign Het
Zfp568 A G 7: 29,722,702 (GRCm39) H549R probably damaging Het
Other mutations in Cemip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Cemip2 APN 19 21,822,121 (GRCm39) missense possibly damaging 0.77
IGL01528:Cemip2 APN 19 21,812,909 (GRCm39) missense possibly damaging 0.95
IGL01642:Cemip2 APN 19 21,801,265 (GRCm39) missense probably damaging 1.00
IGL01693:Cemip2 APN 19 21,779,251 (GRCm39) missense probably benign 0.00
IGL02437:Cemip2 APN 19 21,789,342 (GRCm39) critical splice donor site probably null
IGL02869:Cemip2 APN 19 21,789,241 (GRCm39) missense probably damaging 0.99
IGL02880:Cemip2 APN 19 21,801,207 (GRCm39) missense possibly damaging 0.68
IGL02904:Cemip2 APN 19 21,801,207 (GRCm39) missense possibly damaging 0.68
IGL02941:Cemip2 APN 19 21,801,207 (GRCm39) missense possibly damaging 0.68
IGL02950:Cemip2 APN 19 21,819,564 (GRCm39) missense probably benign 0.07
IGL03066:Cemip2 APN 19 21,801,207 (GRCm39) missense possibly damaging 0.68
IGL03120:Cemip2 APN 19 21,801,207 (GRCm39) missense possibly damaging 0.68
R0005:Cemip2 UTSW 19 21,789,584 (GRCm39) missense probably damaging 0.98
R0496:Cemip2 UTSW 19 21,774,709 (GRCm39) missense possibly damaging 0.89
R0557:Cemip2 UTSW 19 21,789,267 (GRCm39) missense probably benign 0.05
R0620:Cemip2 UTSW 19 21,795,335 (GRCm39) missense probably benign
R1271:Cemip2 UTSW 19 21,801,268 (GRCm39) missense possibly damaging 0.92
R1435:Cemip2 UTSW 19 21,822,070 (GRCm39) missense probably benign
R1543:Cemip2 UTSW 19 21,789,937 (GRCm39) missense probably benign 0.03
R1558:Cemip2 UTSW 19 21,775,346 (GRCm39) nonsense probably null
R1658:Cemip2 UTSW 19 21,779,243 (GRCm39) missense probably damaging 1.00
R1744:Cemip2 UTSW 19 21,809,501 (GRCm39) nonsense probably null
R1859:Cemip2 UTSW 19 21,825,341 (GRCm39) missense possibly damaging 0.56
R1943:Cemip2 UTSW 19 21,825,404 (GRCm39) splice site probably null
R2001:Cemip2 UTSW 19 21,779,351 (GRCm39) missense probably benign 0.43
R2021:Cemip2 UTSW 19 21,822,114 (GRCm39) missense possibly damaging 0.91
R2177:Cemip2 UTSW 19 21,789,149 (GRCm39) missense possibly damaging 0.80
R2183:Cemip2 UTSW 19 21,801,157 (GRCm39) missense possibly damaging 0.81
R2921:Cemip2 UTSW 19 21,795,303 (GRCm39) missense possibly damaging 0.80
R2922:Cemip2 UTSW 19 21,795,303 (GRCm39) missense possibly damaging 0.80
R2923:Cemip2 UTSW 19 21,795,303 (GRCm39) missense possibly damaging 0.80
R3727:Cemip2 UTSW 19 21,822,075 (GRCm39) missense probably benign
R3730:Cemip2 UTSW 19 21,803,481 (GRCm39) missense probably damaging 0.97
R3790:Cemip2 UTSW 19 21,784,816 (GRCm39) missense probably damaging 1.00
R3831:Cemip2 UTSW 19 21,825,315 (GRCm39) missense probably damaging 0.97
R3858:Cemip2 UTSW 19 21,829,598 (GRCm39) missense probably benign 0.01
R3859:Cemip2 UTSW 19 21,829,598 (GRCm39) missense probably benign 0.01
R3899:Cemip2 UTSW 19 21,829,598 (GRCm39) missense probably benign 0.01
R4096:Cemip2 UTSW 19 21,770,016 (GRCm39) start codon destroyed probably null 0.99
R4206:Cemip2 UTSW 19 21,819,479 (GRCm39) missense probably damaging 1.00
R4480:Cemip2 UTSW 19 21,792,853 (GRCm39) missense probably benign 0.03
R4667:Cemip2 UTSW 19 21,774,715 (GRCm39) missense probably benign 0.00
R4888:Cemip2 UTSW 19 21,833,528 (GRCm39) missense probably benign 0.00
R4914:Cemip2 UTSW 19 21,786,653 (GRCm39) missense probably benign 0.00
R5030:Cemip2 UTSW 19 21,819,469 (GRCm39) missense probably benign
R5329:Cemip2 UTSW 19 21,775,693 (GRCm39) missense probably benign 0.30
R5977:Cemip2 UTSW 19 21,803,447 (GRCm39) missense probably benign 0.01
R6013:Cemip2 UTSW 19 21,809,403 (GRCm39) missense possibly damaging 0.89
R6049:Cemip2 UTSW 19 21,803,490 (GRCm39) missense probably benign
R6199:Cemip2 UTSW 19 21,822,186 (GRCm39) missense probably benign 0.05
R6215:Cemip2 UTSW 19 21,789,751 (GRCm39) missense probably benign 0.02
R6273:Cemip2 UTSW 19 21,779,369 (GRCm39) missense probably damaging 1.00
R6429:Cemip2 UTSW 19 21,779,272 (GRCm39) missense probably benign 0.14
R6547:Cemip2 UTSW 19 21,822,195 (GRCm39) missense probably benign 0.01
R6630:Cemip2 UTSW 19 21,829,593 (GRCm39) missense probably damaging 0.99
R6870:Cemip2 UTSW 19 21,809,487 (GRCm39) missense possibly damaging 0.91
R7276:Cemip2 UTSW 19 21,812,824 (GRCm39) missense probably benign 0.14
R7336:Cemip2 UTSW 19 21,803,509 (GRCm39) nonsense probably null
R7363:Cemip2 UTSW 19 21,833,575 (GRCm39) missense probably benign
R7678:Cemip2 UTSW 19 21,775,480 (GRCm39) missense probably damaging 1.00
R7727:Cemip2 UTSW 19 21,807,321 (GRCm39) missense probably benign 0.00
R7820:Cemip2 UTSW 19 21,784,825 (GRCm39) missense probably damaging 0.98
R7837:Cemip2 UTSW 19 21,775,385 (GRCm39) missense probably benign 0.40
R7859:Cemip2 UTSW 19 21,809,539 (GRCm39) missense possibly damaging 0.95
R7954:Cemip2 UTSW 19 21,770,264 (GRCm39) missense probably damaging 1.00
R7964:Cemip2 UTSW 19 21,775,794 (GRCm39) critical splice donor site probably null
R8058:Cemip2 UTSW 19 21,829,695 (GRCm39) missense probably benign 0.12
R8251:Cemip2 UTSW 19 21,784,765 (GRCm39) missense possibly damaging 0.82
R8746:Cemip2 UTSW 19 21,803,465 (GRCm39) missense probably damaging 1.00
R8820:Cemip2 UTSW 19 21,784,818 (GRCm39) missense probably damaging 0.99
R8931:Cemip2 UTSW 19 21,770,323 (GRCm39) missense probably benign 0.01
R9022:Cemip2 UTSW 19 21,789,986 (GRCm39) critical splice donor site probably null
R9354:Cemip2 UTSW 19 21,779,389 (GRCm39) missense probably benign 0.00
R9480:Cemip2 UTSW 19 21,775,622 (GRCm39) missense possibly damaging 0.64
R9495:Cemip2 UTSW 19 21,779,249 (GRCm39) missense probably damaging 0.99
R9593:Cemip2 UTSW 19 21,803,453 (GRCm39) missense probably damaging 1.00
R9705:Cemip2 UTSW 19 21,784,788 (GRCm39) missense probably damaging 0.96
R9740:Cemip2 UTSW 19 21,822,105 (GRCm39) missense probably benign 0.00
Z1177:Cemip2 UTSW 19 21,833,093 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAACATCAGTTGGCTTGGTTTC -3'
(R):5'- GCTCTGCTTCTTATGAGCAACAC -3'

Sequencing Primer
(F):5'- CAGTTGGCTTGGTTTCTATTTTACAG -3'
(R):5'- TGAGCAACACATTCTATAACAAACC -3'
Posted On 2015-10-08