Incidental Mutation 'R4668:Ptgs2'
ID 352107
Institutional Source Beutler Lab
Gene Symbol Ptgs2
Ensembl Gene ENSMUSG00000032487
Gene Name prostaglandin-endoperoxide synthase 2
Synonyms prostaglandin G/H synthase, Pghs2, PGHS-2, cyclooxygenase-2, cyclooxygenase 2, COX2, Cox-2, Tis10, PHS-2
Accession Numbers
Essential gene? Probably essential (E-score: 0.786) question?
Stock # R4668 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 149975851-149983978 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 149976835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 23 (T23A)
Ref Sequence ENSEMBL: ENSMUSP00000139904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035065] [ENSMUST00000190784]
AlphaFold Q05769
Predicted Effect probably benign
Transcript: ENSMUST00000035065
AA Change: T55A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000035065
Gene: ENSMUSG00000032487
AA Change: T55A

DomainStartEndE-ValueType
EGF 20 55 2.64e1 SMART
low complexity region 182 198 N/A INTRINSIC
Pfam:An_peroxidase 206 562 7.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181915
Predicted Effect probably benign
Transcript: ENSMUST00000190784
AA Change: T23A

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139904
Gene: ENSMUSG00000032487
AA Change: T23A

DomainStartEndE-ValueType
Blast:EGF 1 23 2e-9 BLAST
SCOP:d1eqga2 1 26 5e-8 SMART
PDB:1CVU|B 1 62 1e-38 PDB
SCOP:d1cvua1 27 62 1e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that is a member of the prostaglandin G/H synthase family. The encoded protein converts arachidonic acid to prostaglandin endoperoxide H2 which is a key enzymatic step in prostaglandin biosynthesis. This gene is the inducible prostaglandin G/H synthase family member that is upregulated during inflammation. Aberrant regulation of this gene is associated with cancer progression in several tissues and an increased risk of cardiovascular events. This gene is the target of many non-steroidal anti-inflammatory drugs. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit increased perinatal mortality associated with frequent lack of closure and remodeling of the ductus arteriosus, background-sensitive kidney dysplasia with microcyst formation, and myocardial fibrosis. Mutant females show impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A T 9: 114,133,779 (GRCm39) noncoding transcript Het
6430548M08Rik T C 8: 120,887,153 (GRCm39) probably null Het
Abca4 G A 3: 121,948,948 (GRCm39) G531E possibly damaging Het
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Acot10 T C 15: 20,666,028 (GRCm39) S238G probably benign Het
Adamtsl2 A T 2: 26,985,487 (GRCm39) H457L probably benign Het
Ankrd35 A T 3: 96,586,524 (GRCm39) T67S probably damaging Het
Aox1 T G 1: 58,373,853 (GRCm39) I838S possibly damaging Het
Arnt2 T C 7: 83,924,594 (GRCm39) N411S probably damaging Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Carns1 A T 19: 4,215,475 (GRCm39) Y902* probably null Het
Cavin1 T C 11: 100,849,622 (GRCm39) E336G probably damaging Het
Cbl A T 9: 44,065,145 (GRCm39) C728S probably benign Het
Ccdc136 C A 6: 29,411,280 (GRCm39) Q218K probably damaging Het
Cdk19 C A 10: 40,342,706 (GRCm39) T196K probably damaging Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Ces3a A C 8: 105,780,055 (GRCm39) K299T probably damaging Het
Cfap61 A T 2: 145,985,056 (GRCm39) I967F probably damaging Het
Cnksr1 C T 4: 133,960,282 (GRCm39) probably benign Het
Cped1 T C 6: 22,237,652 (GRCm39) Y923H probably benign Het
Crip3 T C 17: 46,740,290 (GRCm39) L30P probably damaging Het
Csmd1 A G 8: 16,073,905 (GRCm39) I2030T possibly damaging Het
Ctse C A 1: 131,590,487 (GRCm39) P70T probably damaging Het
Cyp2b23 A G 7: 26,372,159 (GRCm39) F429L probably damaging Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
D8Ertd738e A T 8: 84,976,110 (GRCm39) L46* probably null Het
Dcp2 T A 18: 44,548,429 (GRCm39) probably null Het
Ddx10 C A 9: 53,010,513 (GRCm39) D834Y possibly damaging Het
Ddx19a A T 8: 111,705,716 (GRCm39) V245E probably damaging Het
Dpf2 A C 19: 5,954,515 (GRCm39) D130E probably benign Het
Emc8 A T 8: 121,394,518 (GRCm39) M67K probably damaging Het
Ephb6 T C 6: 41,591,536 (GRCm39) L231P possibly damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
Esco1 A T 18: 10,594,734 (GRCm39) I184N possibly damaging Het
Fdxacb1 T A 9: 50,681,560 (GRCm39) D11E possibly damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnip1 T A 11: 54,394,385 (GRCm39) S940R probably damaging Het
Ganc G T 2: 120,261,548 (GRCm39) V343F probably benign Het
Gldn T A 9: 54,239,302 (GRCm39) L228* probably null Het
Gm1123 C T 9: 98,891,426 (GRCm39) R341H probably damaging Het
Gtf2f2 T C 14: 76,155,078 (GRCm39) Y161C probably benign Het
Gtf3c1 T C 7: 125,266,510 (GRCm39) T979A probably damaging Het
H4c1 A G 13: 23,944,959 (GRCm39) V61A probably benign Het
Hmcn2 G T 2: 31,325,804 (GRCm39) R4277L probably benign Het
Hsd17b6 T A 10: 127,830,295 (GRCm39) probably null Het
Igkv12-46 T C 6: 69,741,781 (GRCm39) T25A probably damaging Het
Inpp5e G A 2: 26,291,006 (GRCm39) R354C probably damaging Het
Jcad T A 18: 4,680,221 (GRCm39) probably null Het
Kcna10 G T 3: 107,102,010 (GRCm39) A214S possibly damaging Het
Kit T C 5: 75,801,880 (GRCm39) probably null Het
Kmt2a G A 9: 44,735,869 (GRCm39) probably benign Het
Lama1 T C 17: 68,059,429 (GRCm39) V604A probably benign Het
Mesd T C 7: 83,544,964 (GRCm39) V138A probably damaging Het
Mmp13 T C 9: 7,272,580 (GRCm39) F9S possibly damaging Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Mrc1 A C 2: 14,298,297 (GRCm39) T718P probably damaging Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Myh10 A G 11: 68,695,468 (GRCm39) K1532E probably damaging Het
Nat9 T C 11: 115,075,368 (GRCm39) N91S probably damaging Het
Neto2 A T 8: 86,367,691 (GRCm39) I351N probably damaging Het
Nfx1 A G 4: 40,976,367 (GRCm39) N14D possibly damaging Het
Nlrp4b A G 7: 10,448,660 (GRCm39) T288A possibly damaging Het
Nutm2 C A 13: 50,627,033 (GRCm39) T396K probably benign Het
Ogdhl A G 14: 32,054,493 (GRCm39) T196A probably benign Het
Omg T A 11: 79,393,249 (GRCm39) N203I probably damaging Het
Or52b4i A G 7: 102,191,811 (GRCm39) I223V possibly damaging Het
Or52r1b A T 7: 102,691,058 (GRCm39) D119V probably benign Het
Or5b101 A T 19: 13,005,445 (GRCm39) F83I probably benign Het
Pdgfrb A G 18: 61,197,185 (GRCm39) Y207C probably damaging Het
Pdzd7 T A 19: 45,034,126 (GRCm39) probably benign Het
Pgs1 C A 11: 117,894,333 (GRCm39) H157N probably damaging Het
Pik3c2a A G 7: 115,957,923 (GRCm39) V1121A probably benign Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Pms1 G A 1: 53,228,633 (GRCm39) Q872* probably null Het
Rgl1 T G 1: 152,397,122 (GRCm39) R716S probably damaging Het
Rif1 A G 2: 52,001,964 (GRCm39) E1806G probably benign Het
Ripor1 T C 8: 106,341,284 (GRCm39) V39A probably benign Het
Ryr2 G T 13: 11,608,003 (GRCm39) T868N probably benign Het
Sec22b A T 3: 97,828,438 (GRCm39) D167V probably damaging Het
Sec24d T C 3: 123,149,423 (GRCm39) V810A probably damaging Het
Shh T C 5: 28,662,853 (GRCm39) *438W probably null Het
Slc25a12 G A 2: 71,145,406 (GRCm39) S178L probably benign Het
Sorl1 A T 9: 41,895,804 (GRCm39) W1784R probably damaging Het
Sp3 A T 2: 72,801,325 (GRCm39) S229R probably damaging Het
Spata31f3 A G 4: 42,871,608 (GRCm39) F256L probably benign Het
Spdye4c G A 2: 128,434,273 (GRCm39) V5I possibly damaging Het
Spint2 A T 7: 28,959,804 (GRCm39) V53D probably damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Stk25 A G 1: 93,553,205 (GRCm39) S299P probably damaging Het
Sult2a3 A G 7: 13,856,786 (GRCm39) S45P probably damaging Het
Thsd7a A T 6: 12,408,967 (GRCm39) V685E probably damaging Het
Tm9sf4 T A 2: 153,029,228 (GRCm39) V92D probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Topors G A 4: 40,262,669 (GRCm39) T205I probably damaging Het
Tpo T A 12: 30,153,289 (GRCm39) Y355F probably benign Het
Uba1y T A Y: 826,032 (GRCm39) M396K possibly damaging Het
Vmn1r50 A T 6: 90,084,513 (GRCm39) Q86L probably benign Het
Vmn1r77 A G 7: 11,775,358 (GRCm39) K45E probably damaging Het
Vmn2r114 A C 17: 23,529,447 (GRCm39) N218K possibly damaging Het
Vmn2r66 T A 7: 84,643,905 (GRCm39) N835I probably damaging Het
Vps54 T G 11: 21,249,989 (GRCm39) N458K probably benign Het
Zcchc7 G T 4: 44,895,964 (GRCm39) C304F probably damaging Het
Zfp335 A T 2: 164,742,206 (GRCm39) C593S probably damaging Het
Zmynd15 C G 11: 70,353,414 (GRCm39) P214R probably damaging Het
Other mutations in Ptgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Ptgs2 APN 1 149,980,175 (GRCm39) missense probably damaging 1.00
IGL01626:Ptgs2 APN 1 149,979,478 (GRCm39) missense probably damaging 1.00
IGL01758:Ptgs2 APN 1 149,977,740 (GRCm39) critical splice acceptor site probably null
IGL02168:Ptgs2 APN 1 149,979,430 (GRCm39) splice site probably null
IGL02309:Ptgs2 APN 1 149,981,307 (GRCm39) missense probably damaging 1.00
IGL02363:Ptgs2 APN 1 149,981,460 (GRCm39) splice site probably null
IGL02574:Ptgs2 APN 1 149,978,526 (GRCm39) nonsense probably null
IGL03156:Ptgs2 APN 1 149,981,228 (GRCm39) missense probably damaging 1.00
R0436:Ptgs2 UTSW 1 149,980,028 (GRCm39) unclassified probably benign
R0629:Ptgs2 UTSW 1 149,976,788 (GRCm39) missense probably benign
R0631:Ptgs2 UTSW 1 149,980,288 (GRCm39) missense probably benign 0.30
R0811:Ptgs2 UTSW 1 149,977,105 (GRCm39) missense probably benign 0.03
R0812:Ptgs2 UTSW 1 149,977,105 (GRCm39) missense probably benign 0.03
R0980:Ptgs2 UTSW 1 149,980,061 (GRCm39) missense probably damaging 1.00
R1340:Ptgs2 UTSW 1 149,981,228 (GRCm39) missense probably damaging 1.00
R1626:Ptgs2 UTSW 1 149,979,619 (GRCm39) critical splice acceptor site probably null
R1666:Ptgs2 UTSW 1 149,977,021 (GRCm39) missense probably damaging 1.00
R1742:Ptgs2 UTSW 1 149,980,150 (GRCm39) missense probably damaging 1.00
R1926:Ptgs2 UTSW 1 149,975,979 (GRCm39) missense possibly damaging 0.48
R2148:Ptgs2 UTSW 1 149,981,465 (GRCm39) missense probably benign
R2361:Ptgs2 UTSW 1 149,979,726 (GRCm39) missense probably benign 0.00
R2927:Ptgs2 UTSW 1 149,977,011 (GRCm39) missense possibly damaging 0.95
R3966:Ptgs2 UTSW 1 149,981,226 (GRCm39) missense probably damaging 0.99
R4291:Ptgs2 UTSW 1 149,976,002 (GRCm39) missense probably benign
R4580:Ptgs2 UTSW 1 149,979,845 (GRCm39) missense possibly damaging 0.78
R4751:Ptgs2 UTSW 1 149,979,771 (GRCm39) missense probably damaging 1.00
R4777:Ptgs2 UTSW 1 149,981,138 (GRCm39) missense probably benign 0.03
R5264:Ptgs2 UTSW 1 149,978,481 (GRCm39) missense possibly damaging 0.62
R5570:Ptgs2 UTSW 1 149,979,859 (GRCm39) missense
R5587:Ptgs2 UTSW 1 149,981,306 (GRCm39) missense probably damaging 1.00
R5761:Ptgs2 UTSW 1 149,981,279 (GRCm39) missense probably benign 0.18
R5850:Ptgs2 UTSW 1 149,981,127 (GRCm39) missense probably benign 0.03
R6137:Ptgs2 UTSW 1 149,976,744 (GRCm39) missense probably benign 0.08
R6513:Ptgs2 UTSW 1 149,975,879 (GRCm39) unclassified probably benign
R6553:Ptgs2 UTSW 1 149,979,738 (GRCm39) missense possibly damaging 0.93
R6585:Ptgs2 UTSW 1 149,979,738 (GRCm39) missense possibly damaging 0.93
R6593:Ptgs2 UTSW 1 149,976,784 (GRCm39) missense possibly damaging 0.63
R6772:Ptgs2 UTSW 1 149,977,829 (GRCm39) missense probably damaging 1.00
R6850:Ptgs2 UTSW 1 149,981,291 (GRCm39) missense probably damaging 1.00
R7205:Ptgs2 UTSW 1 149,978,512 (GRCm39) missense probably benign 0.01
R7320:Ptgs2 UTSW 1 149,978,446 (GRCm39) missense probably damaging 1.00
R7567:Ptgs2 UTSW 1 149,978,448 (GRCm39) missense probably damaging 0.99
R7751:Ptgs2 UTSW 1 149,980,258 (GRCm39) missense probably benign 0.14
R7863:Ptgs2 UTSW 1 149,977,090 (GRCm39) missense probably damaging 1.00
R8100:Ptgs2 UTSW 1 149,978,472 (GRCm39) missense probably damaging 1.00
R8117:Ptgs2 UTSW 1 149,979,785 (GRCm39) missense probably damaging 1.00
R8128:Ptgs2 UTSW 1 149,977,099 (GRCm39) missense probably damaging 0.99
R8906:Ptgs2 UTSW 1 149,979,859 (GRCm39) missense
R8964:Ptgs2 UTSW 1 149,980,798 (GRCm39) missense probably damaging 1.00
R9184:Ptgs2 UTSW 1 149,980,175 (GRCm39) missense probably damaging 1.00
R9563:Ptgs2 UTSW 1 149,981,419 (GRCm39) missense probably benign
R9568:Ptgs2 UTSW 1 149,976,842 (GRCm39) critical splice donor site probably null
R9615:Ptgs2 UTSW 1 149,980,802 (GRCm39) missense probably damaging 1.00
Z1176:Ptgs2 UTSW 1 149,981,472 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCCATAGTGACAGAATTAAATCC -3'
(R):5'- CCTTGAAGTGGGTCAGGATG -3'

Sequencing Primer
(F):5'- ATCCTTAAGTTAAGATGAGAACAACC -3'
(R):5'- GGGTCAGGATGTAGTGCAC -3'
Posted On 2015-10-08