Incidental Mutation 'R4668:Rgl1'
ID 352108
Institutional Source Beutler Lab
Gene Symbol Rgl1
Ensembl Gene ENSMUSG00000026482
Gene Name ral guanine nucleotide dissociation stimulator,-like 1
Synonyms Rgl
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R4668 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 152392513-152642089 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 152397122 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 716 (R716S)
Ref Sequence ENSEMBL: ENSMUSP00000107490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859]
AlphaFold Q60695
Predicted Effect probably damaging
Transcript: ENSMUST00000027760
AA Change: R681S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: R681S

DomainStartEndE-ValueType
RasGEFN 64 196 5.86e-39 SMART
RasGEF 228 502 9.56e-116 SMART
Blast:RasGEF 522 582 6e-8 BLAST
low complexity region 585 596 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
RA 648 735 1.7e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111857
AA Change: R679S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: R679S

DomainStartEndE-ValueType
RasGEFN 62 194 5.86e-39 SMART
RasGEF 226 500 9.56e-116 SMART
Blast:RasGEF 520 580 7e-8 BLAST
low complexity region 583 594 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
RA 646 733 1.7e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111859
AA Change: R716S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: R716S

DomainStartEndE-ValueType
RasGEFN 99 231 5.86e-39 SMART
RasGEF 263 537 9.56e-116 SMART
Blast:RasGEF 557 617 6e-8 BLAST
low complexity region 620 631 N/A INTRINSIC
low complexity region 662 672 N/A INTRINSIC
RA 683 770 1.7e-25 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A T 9: 114,133,779 (GRCm39) noncoding transcript Het
6430548M08Rik T C 8: 120,887,153 (GRCm39) probably null Het
Abca4 G A 3: 121,948,948 (GRCm39) G531E possibly damaging Het
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Acot10 T C 15: 20,666,028 (GRCm39) S238G probably benign Het
Adamtsl2 A T 2: 26,985,487 (GRCm39) H457L probably benign Het
Ankrd35 A T 3: 96,586,524 (GRCm39) T67S probably damaging Het
Aox1 T G 1: 58,373,853 (GRCm39) I838S possibly damaging Het
Arnt2 T C 7: 83,924,594 (GRCm39) N411S probably damaging Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Carns1 A T 19: 4,215,475 (GRCm39) Y902* probably null Het
Cavin1 T C 11: 100,849,622 (GRCm39) E336G probably damaging Het
Cbl A T 9: 44,065,145 (GRCm39) C728S probably benign Het
Ccdc136 C A 6: 29,411,280 (GRCm39) Q218K probably damaging Het
Cdk19 C A 10: 40,342,706 (GRCm39) T196K probably damaging Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Ces3a A C 8: 105,780,055 (GRCm39) K299T probably damaging Het
Cfap61 A T 2: 145,985,056 (GRCm39) I967F probably damaging Het
Cnksr1 C T 4: 133,960,282 (GRCm39) probably benign Het
Cped1 T C 6: 22,237,652 (GRCm39) Y923H probably benign Het
Crip3 T C 17: 46,740,290 (GRCm39) L30P probably damaging Het
Csmd1 A G 8: 16,073,905 (GRCm39) I2030T possibly damaging Het
Ctse C A 1: 131,590,487 (GRCm39) P70T probably damaging Het
Cyp2b23 A G 7: 26,372,159 (GRCm39) F429L probably damaging Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
D8Ertd738e A T 8: 84,976,110 (GRCm39) L46* probably null Het
Dcp2 T A 18: 44,548,429 (GRCm39) probably null Het
Ddx10 C A 9: 53,010,513 (GRCm39) D834Y possibly damaging Het
Ddx19a A T 8: 111,705,716 (GRCm39) V245E probably damaging Het
Dpf2 A C 19: 5,954,515 (GRCm39) D130E probably benign Het
Emc8 A T 8: 121,394,518 (GRCm39) M67K probably damaging Het
Ephb6 T C 6: 41,591,536 (GRCm39) L231P possibly damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
Esco1 A T 18: 10,594,734 (GRCm39) I184N possibly damaging Het
Fdxacb1 T A 9: 50,681,560 (GRCm39) D11E possibly damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnip1 T A 11: 54,394,385 (GRCm39) S940R probably damaging Het
Ganc G T 2: 120,261,548 (GRCm39) V343F probably benign Het
Gldn T A 9: 54,239,302 (GRCm39) L228* probably null Het
Gm1123 C T 9: 98,891,426 (GRCm39) R341H probably damaging Het
Gtf2f2 T C 14: 76,155,078 (GRCm39) Y161C probably benign Het
Gtf3c1 T C 7: 125,266,510 (GRCm39) T979A probably damaging Het
H4c1 A G 13: 23,944,959 (GRCm39) V61A probably benign Het
Hmcn2 G T 2: 31,325,804 (GRCm39) R4277L probably benign Het
Hsd17b6 T A 10: 127,830,295 (GRCm39) probably null Het
Igkv12-46 T C 6: 69,741,781 (GRCm39) T25A probably damaging Het
Inpp5e G A 2: 26,291,006 (GRCm39) R354C probably damaging Het
Jcad T A 18: 4,680,221 (GRCm39) probably null Het
Kcna10 G T 3: 107,102,010 (GRCm39) A214S possibly damaging Het
Kit T C 5: 75,801,880 (GRCm39) probably null Het
Kmt2a G A 9: 44,735,869 (GRCm39) probably benign Het
Lama1 T C 17: 68,059,429 (GRCm39) V604A probably benign Het
Mesd T C 7: 83,544,964 (GRCm39) V138A probably damaging Het
Mmp13 T C 9: 7,272,580 (GRCm39) F9S possibly damaging Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Mrc1 A C 2: 14,298,297 (GRCm39) T718P probably damaging Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Myh10 A G 11: 68,695,468 (GRCm39) K1532E probably damaging Het
Nat9 T C 11: 115,075,368 (GRCm39) N91S probably damaging Het
Neto2 A T 8: 86,367,691 (GRCm39) I351N probably damaging Het
Nfx1 A G 4: 40,976,367 (GRCm39) N14D possibly damaging Het
Nlrp4b A G 7: 10,448,660 (GRCm39) T288A possibly damaging Het
Nutm2 C A 13: 50,627,033 (GRCm39) T396K probably benign Het
Ogdhl A G 14: 32,054,493 (GRCm39) T196A probably benign Het
Omg T A 11: 79,393,249 (GRCm39) N203I probably damaging Het
Or52b4i A G 7: 102,191,811 (GRCm39) I223V possibly damaging Het
Or52r1b A T 7: 102,691,058 (GRCm39) D119V probably benign Het
Or5b101 A T 19: 13,005,445 (GRCm39) F83I probably benign Het
Pdgfrb A G 18: 61,197,185 (GRCm39) Y207C probably damaging Het
Pdzd7 T A 19: 45,034,126 (GRCm39) probably benign Het
Pgs1 C A 11: 117,894,333 (GRCm39) H157N probably damaging Het
Pik3c2a A G 7: 115,957,923 (GRCm39) V1121A probably benign Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Pms1 G A 1: 53,228,633 (GRCm39) Q872* probably null Het
Ptgs2 A G 1: 149,976,835 (GRCm39) T23A probably benign Het
Rif1 A G 2: 52,001,964 (GRCm39) E1806G probably benign Het
Ripor1 T C 8: 106,341,284 (GRCm39) V39A probably benign Het
Ryr2 G T 13: 11,608,003 (GRCm39) T868N probably benign Het
Sec22b A T 3: 97,828,438 (GRCm39) D167V probably damaging Het
Sec24d T C 3: 123,149,423 (GRCm39) V810A probably damaging Het
Shh T C 5: 28,662,853 (GRCm39) *438W probably null Het
Slc25a12 G A 2: 71,145,406 (GRCm39) S178L probably benign Het
Sorl1 A T 9: 41,895,804 (GRCm39) W1784R probably damaging Het
Sp3 A T 2: 72,801,325 (GRCm39) S229R probably damaging Het
Spata31f3 A G 4: 42,871,608 (GRCm39) F256L probably benign Het
Spdye4c G A 2: 128,434,273 (GRCm39) V5I possibly damaging Het
Spint2 A T 7: 28,959,804 (GRCm39) V53D probably damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Stk25 A G 1: 93,553,205 (GRCm39) S299P probably damaging Het
Sult2a3 A G 7: 13,856,786 (GRCm39) S45P probably damaging Het
Thsd7a A T 6: 12,408,967 (GRCm39) V685E probably damaging Het
Tm9sf4 T A 2: 153,029,228 (GRCm39) V92D probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Topors G A 4: 40,262,669 (GRCm39) T205I probably damaging Het
Tpo T A 12: 30,153,289 (GRCm39) Y355F probably benign Het
Uba1y T A Y: 826,032 (GRCm39) M396K possibly damaging Het
Vmn1r50 A T 6: 90,084,513 (GRCm39) Q86L probably benign Het
Vmn1r77 A G 7: 11,775,358 (GRCm39) K45E probably damaging Het
Vmn2r114 A C 17: 23,529,447 (GRCm39) N218K possibly damaging Het
Vmn2r66 T A 7: 84,643,905 (GRCm39) N835I probably damaging Het
Vps54 T G 11: 21,249,989 (GRCm39) N458K probably benign Het
Zcchc7 G T 4: 44,895,964 (GRCm39) C304F probably damaging Het
Zfp335 A T 2: 164,742,206 (GRCm39) C593S probably damaging Het
Zmynd15 C G 11: 70,353,414 (GRCm39) P214R probably damaging Het
Other mutations in Rgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Rgl1 APN 1 152,447,368 (GRCm39) missense probably benign 0.02
IGL01065:Rgl1 APN 1 152,394,893 (GRCm39) missense probably damaging 1.00
IGL01390:Rgl1 APN 1 152,447,339 (GRCm39) splice site probably benign
IGL01726:Rgl1 APN 1 152,394,904 (GRCm39) missense probably damaging 1.00
IGL01837:Rgl1 APN 1 152,424,901 (GRCm39) missense probably damaging 1.00
IGL02019:Rgl1 APN 1 152,404,220 (GRCm39) splice site probably benign
IGL02369:Rgl1 APN 1 152,409,357 (GRCm39) missense probably damaging 1.00
R0240:Rgl1 UTSW 1 152,430,175 (GRCm39) unclassified probably benign
R0255:Rgl1 UTSW 1 152,428,347 (GRCm39) missense probably damaging 1.00
R0562:Rgl1 UTSW 1 152,415,696 (GRCm39) missense probably damaging 1.00
R0648:Rgl1 UTSW 1 152,412,016 (GRCm39) critical splice donor site probably null
R0734:Rgl1 UTSW 1 152,430,051 (GRCm39) missense probably damaging 0.98
R1187:Rgl1 UTSW 1 152,420,184 (GRCm39) missense probably benign 0.14
R1522:Rgl1 UTSW 1 152,462,284 (GRCm39) missense probably damaging 1.00
R1595:Rgl1 UTSW 1 152,550,774 (GRCm39) splice site probably benign
R1634:Rgl1 UTSW 1 152,400,523 (GRCm39) missense probably damaging 1.00
R1661:Rgl1 UTSW 1 152,409,326 (GRCm39) missense probably damaging 0.99
R1665:Rgl1 UTSW 1 152,409,326 (GRCm39) missense probably damaging 0.99
R1964:Rgl1 UTSW 1 152,424,855 (GRCm39) missense probably damaging 1.00
R2291:Rgl1 UTSW 1 152,412,032 (GRCm39) missense probably damaging 1.00
R4272:Rgl1 UTSW 1 152,412,040 (GRCm39) missense probably benign 0.13
R4669:Rgl1 UTSW 1 152,397,122 (GRCm39) missense probably damaging 1.00
R4747:Rgl1 UTSW 1 152,400,450 (GRCm39) nonsense probably null
R4830:Rgl1 UTSW 1 152,430,081 (GRCm39) missense probably benign 0.11
R4853:Rgl1 UTSW 1 152,433,325 (GRCm39) missense probably benign 0.07
R4969:Rgl1 UTSW 1 152,424,813 (GRCm39) splice site probably null
R5778:Rgl1 UTSW 1 152,428,172 (GRCm39) missense probably benign 0.05
R5979:Rgl1 UTSW 1 152,433,244 (GRCm39) missense probably damaging 1.00
R6180:Rgl1 UTSW 1 152,394,923 (GRCm39) missense probably damaging 1.00
R6183:Rgl1 UTSW 1 152,462,321 (GRCm39) missense possibly damaging 0.94
R6322:Rgl1 UTSW 1 152,428,186 (GRCm39) missense probably damaging 0.98
R6678:Rgl1 UTSW 1 152,400,475 (GRCm39) missense probably damaging 1.00
R6759:Rgl1 UTSW 1 152,409,281 (GRCm39) missense probably damaging 0.99
R6892:Rgl1 UTSW 1 152,415,691 (GRCm39) missense probably benign 0.00
R7290:Rgl1 UTSW 1 152,420,146 (GRCm39) missense possibly damaging 0.78
R7363:Rgl1 UTSW 1 152,394,914 (GRCm39) missense probably damaging 1.00
R7610:Rgl1 UTSW 1 152,428,371 (GRCm39) missense probably damaging 1.00
R7774:Rgl1 UTSW 1 152,430,101 (GRCm39) missense probably benign
R8140:Rgl1 UTSW 1 152,433,252 (GRCm39) missense probably damaging 1.00
R9188:Rgl1 UTSW 1 152,394,922 (GRCm39) missense probably damaging 1.00
R9190:Rgl1 UTSW 1 152,428,362 (GRCm39) missense probably damaging 0.96
R9297:Rgl1 UTSW 1 152,400,454 (GRCm39) missense possibly damaging 0.89
R9318:Rgl1 UTSW 1 152,400,454 (GRCm39) missense possibly damaging 0.89
R9491:Rgl1 UTSW 1 152,424,869 (GRCm39) missense probably damaging 1.00
R9570:Rgl1 UTSW 1 152,430,082 (GRCm39) missense possibly damaging 0.47
R9610:Rgl1 UTSW 1 152,397,115 (GRCm39) missense probably benign 0.13
R9640:Rgl1 UTSW 1 152,397,142 (GRCm39) missense probably damaging 1.00
RF005:Rgl1 UTSW 1 152,397,114 (GRCm39) missense probably benign
Z1088:Rgl1 UTSW 1 152,550,771 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TATGTGCATATGCCCCTGCC -3'
(R):5'- TTCACCTGCTCATTCAGAAGTAG -3'

Sequencing Primer
(F):5'- TGCCATCACTAGGATCCAAATG -3'
(R):5'- CCTGCTCATTCAGAAGTAGTACTAGC -3'
Posted On 2015-10-08