Mutagenetix > Incidental Mutation

Incidental Mutation 'R4668:Sp3'

352117

Institutional Source

Beutler Lab

Gene Symbol

Sp3

Ensembl Gene

ENSMUSG00000027109

Gene Name

trans-acting transcription factor 3

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4668 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72936427-72980446 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72970981 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 229 (S229R)

Ref Sequence

ENSEMBL: ENSMUSP00000065807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066003] [ENSMUST00000102689] [ENSMUST00000112062]

AlphaFold

O70494

Predicted Effect

probably damaging
Transcript: ENSMUST00000066003
AA Change: S229R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065807
Gene: ENSMUSG00000027109
AA Change: S229R

Domain	Start	End	E-Value	Type
low complexity region	14	59	N/A	INTRINSIC
low complexity region	188	201	N/A	INTRINSIC
low complexity region	231	241	N/A	INTRINSIC
low complexity region	387	402	N/A	INTRINSIC
low complexity region	425	448	N/A	INTRINSIC
ZnF_C2H2	579	603	1.86e0	SMART
ZnF_C2H2	609	633	7.37e-4	SMART
ZnF_C2H2	639	661	5.99e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102689
AA Change: S273R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099750
Gene: ENSMUSG00000027109
AA Change: S273R

Domain	Start	End	E-Value	Type
low complexity region	20	51	N/A	INTRINSIC
low complexity region	73	95	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	275	285	N/A	INTRINSIC
low complexity region	431	446	N/A	INTRINSIC
low complexity region	469	492	N/A	INTRINSIC
ZnF_C2H2	623	647	1.86e0	SMART
ZnF_C2H2	653	677	7.37e-4	SMART
ZnF_C2H2	683	705	5.99e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112062

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133615

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141372

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene product belongs to a family of Sp1 related transcription factors, which regulate transcription by binding to consensus GC- and GT-box regulatory elements in target genes. This protein contains a zinc finger DNA-binding domain and several transactivation domains, and has been reported to function as a bifunctional transcription factor that either stimulates or represses transcription of numerous genes. Alternative splicing results in transcript variants encoding different isoforms, and one variant initiates translation from a non-AUG (AUA) codon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a reduced birth body size, skeletal, tooth and hematopoietic defects, and die shortly after birth due to respiratory failure. Homozygous mutant mice bearing a subtle point mutation in the SUMO attachment site show loss of DNAmethylation in sumoylation-deficient MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	A	T	9: 114,304,711		noncoding transcript	Het
6430548M08Rik	T	C	8: 120,160,414		probably null	Het
Abca4	G	A	3: 122,155,299	G531E	possibly damaging	Het
Acad8	A	G	9: 26,990,627	L147P	probably damaging	Het
Acot10	T	C	15: 20,665,942	S238G	probably benign	Het
Adamtsl2	A	T	2: 27,095,475	H457L	probably benign	Het
Ankrd35	A	T	3: 96,679,208	T67S	probably damaging	Het
Aox2	T	G	1: 58,334,694	I838S	possibly damaging	Het
Arnt2	T	C	7: 84,275,386	N411S	probably damaging	Het
Bmpr2	T	C	1: 59,867,716	L656S	probably damaging	Het
Carns1	A	T	19: 4,165,476	Y902*	probably null	Het
Cavin1	T	C	11: 100,958,796	E336G	probably damaging	Het
Cbl	A	T	9: 44,153,848	C728S	probably benign	Het
Ccdc136	C	A	6: 29,411,281	Q218K	probably damaging	Het
Cdk19	C	A	10: 40,466,710	T196K	probably damaging	Het
Ceacam20	T	C	7: 19,986,027	Y495H	probably damaging	Het
Celf2	T	C	2: 6,721,528	I47V	probably benign	Het
Ces3a	A	C	8: 105,053,423	K299T	probably damaging	Het
Cfap61	A	T	2: 146,143,136	I967F	probably damaging	Het
Cnksr1	C	T	4: 134,232,971		probably benign	Het
Cped1	T	C	6: 22,237,653	Y923H	probably benign	Het
Crip3	T	C	17: 46,429,364	L30P	probably damaging	Het
Csmd1	A	G	8: 16,023,891	I2030T	possibly damaging	Het
Ctse	C	A	1: 131,662,749	P70T	probably damaging	Het
Cyp2b23	A	G	7: 26,672,734	F429L	probably damaging	Het
Cyp2c66	T	A	19: 39,176,656	D360E	probably damaging	Het
D8Ertd738e	A	T	8: 84,249,481	L46*	probably null	Het
Dcp2	T	A	18: 44,415,362		probably null	Het
Ddx10	C	A	9: 53,099,213	D834Y	possibly damaging	Het
Ddx19a	A	T	8: 110,979,084	V245E	probably damaging	Het
Dpf2	A	C	19: 5,904,487	D130E	probably benign	Het
Emc8	A	T	8: 120,667,779	M67K	probably damaging	Het
Ephb6	T	C	6: 41,614,602	L231P	possibly damaging	Het
Erp27	T	C	6: 136,908,152	E216G	possibly damaging	Het
Esco1	A	T	18: 10,594,734	I184N	possibly damaging	Het
Fam205c	A	G	4: 42,871,608	F256L	probably benign	Het
Fdxacb1	T	A	9: 50,770,260	D11E	possibly damaging	Het
Fhod3	C	T	18: 25,066,338	P689S	probably benign	Het
Fnip1	T	A	11: 54,503,559	S940R	probably damaging	Het
Ganc	G	T	2: 120,431,067	V343F	probably benign	Het
Gldn	T	A	9: 54,332,018	L228*	probably null	Het
Gm1123	C	T	9: 99,009,373	R341H	probably damaging	Het
Gtf2f2	T	C	14: 75,917,638	Y161C	probably benign	Het
Gtf3c1	T	C	7: 125,667,338	T979A	probably damaging	Het
Hist1h4a	A	G	13: 23,760,976	V61A	probably benign	Het
Hmcn2	G	T	2: 31,435,792	R4277L	probably benign	Het
Hsd17b6	T	A	10: 127,994,426		probably null	Het
Igkv12-46	T	C	6: 69,764,797	T25A	probably damaging	Het
Inpp5e	G	A	2: 26,400,994	R354C	probably damaging	Het
Jcad	T	A	18: 4,680,221		probably null	Het
Kcna10	G	T	3: 107,194,694	A214S	possibly damaging	Het
Kit	T	C	5: 75,641,220		probably null	Het
Kmt2a	G	A	9: 44,824,572		probably benign	Het
Lama1	T	C	17: 67,752,434	V604A	probably benign	Het
Mesd	T	C	7: 83,895,756	V138A	probably damaging	Het
Mmp13	T	C	9: 7,272,580	F9S	possibly damaging	Het
Mocos	T	C	18: 24,666,434	Y242H	probably benign	Het
Mrc1	A	C	2: 14,293,486	T718P	probably damaging	Het
Msh6	T	C	17: 87,984,806	S330P	possibly damaging	Het
Myh10	A	G	11: 68,804,642	K1532E	probably damaging	Het
Nat9	T	C	11: 115,184,542	N91S	probably damaging	Het
Neto2	A	T	8: 85,641,062	I351N	probably damaging	Het
Nfx1	A	G	4: 40,976,367	N14D	possibly damaging	Het
Nlrp4b	A	G	7: 10,714,733	T288A	possibly damaging	Het
Nutm2	C	A	13: 50,472,997	T396K	probably benign	Het
Ogdhl	A	G	14: 32,332,536	T196A	probably benign	Het
Olfr1453	A	T	19: 13,028,081	F83I	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,604	I223V	possibly damaging	Het
Olfr582	A	T	7: 103,041,851	D119V	probably benign	Het
Omg	T	A	11: 79,502,423	N203I	probably damaging	Het
Pdgfrb	A	G	18: 61,064,113	Y207C	probably damaging	Het
Pdzd7	T	A	19: 45,045,687		probably benign	Het
Pgs1	C	A	11: 118,003,507	H157N	probably damaging	Het
Pik3c2a	A	G	7: 116,358,688	V1121A	probably benign	Het
Pikfyve	T	A	1: 65,250,273	C1235S	probably damaging	Het
Pms1	G	A	1: 53,189,474	Q872*	probably null	Het
Ptgs2	A	G	1: 150,101,084	T23A	probably benign	Het
Rgl1	T	G	1: 152,521,371	R716S	probably damaging	Het
Rif1	A	G	2: 52,111,952	E1806G	probably benign	Het
Ripor1	T	C	8: 105,614,652	V39A	probably benign	Het
Ryr2	G	T	13: 11,593,117	T868N	probably benign	Het
Sec22b	A	T	3: 97,921,122	D167V	probably damaging	Het
Sec24d	T	C	3: 123,355,774	V810A	probably damaging	Het
Shh	T	C	5: 28,457,855	*438W	probably null	Het
Slc25a12	G	A	2: 71,315,062	S178L	probably benign	Het
Sorl1	A	T	9: 41,984,508	W1784R	probably damaging	Het
Spdye4c	G	A	2: 128,592,353	V5I	possibly damaging	Het
Spint2	A	T	7: 29,260,379	V53D	probably damaging	Het
Stard3nl	T	A	13: 19,376,519	N29Y	probably damaging	Het
Stk25	A	G	1: 93,625,483	S299P	probably damaging	Het
Sult2a3	A	G	7: 14,122,861	S45P	probably damaging	Het
Thsd7a	A	T	6: 12,408,968	V685E	probably damaging	Het
Tm9sf4	T	A	2: 153,187,308	V92D	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Topors	G	A	4: 40,262,669	T205I	probably damaging	Het
Tpo	T	A	12: 30,103,290	Y355F	probably benign	Het
Uba1y	T	A	Y: 826,032	M396K	possibly damaging	Het
Vmn1r50	A	T	6: 90,107,531	Q86L	probably benign	Het
Vmn1r77	A	G	7: 12,041,431	K45E	probably damaging	Het
Vmn2r114	A	C	17: 23,310,473	N218K	possibly damaging	Het
Vmn2r66	T	A	7: 84,994,697	N835I	probably damaging	Het
Vps54	T	G	11: 21,299,989	N458K	probably benign	Het
Zcchc7	G	T	4: 44,895,964	C304F	probably damaging	Het
Zfp335	A	T	2: 164,900,286	C593S	probably damaging	Het
Zmynd15	C	G	11: 70,462,588	P214R	probably damaging	Het

Other mutations in Sp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Sp3	APN	2	72938062	utr 3 prime	probably benign
IGL02457:Sp3	APN	2	72971469	missense	probably damaging	1.00
R0417:Sp3	UTSW	2	72971501	missense	possibly damaging	0.57
R0539:Sp3	UTSW	2	72970532	missense	possibly damaging	0.90
R0685:Sp3	UTSW	2	72970998	missense	probably damaging	1.00
R1435:Sp3	UTSW	2	72938156	missense	possibly damaging	0.86
R1731:Sp3	UTSW	2	72946655	missense	probably damaging	0.98
R1838:Sp3	UTSW	2	72938176	missense	possibly damaging	0.66
R2283:Sp3	UTSW	2	72971177	missense	possibly damaging	0.95
R3892:Sp3	UTSW	2	72979032	intron	probably benign
R4508:Sp3	UTSW	2	72970397	missense	probably damaging	1.00
R4896:Sp3	UTSW	2	72938289	missense	probably benign	0.18
R5004:Sp3	UTSW	2	72938289	missense	probably benign	0.18
R5381:Sp3	UTSW	2	72970566	missense	probably benign	0.17
R5493:Sp3	UTSW	2	72938122	missense	probably damaging	1.00
R5691:Sp3	UTSW	2	72971459	missense	probably damaging	1.00
R5755:Sp3	UTSW	2	72938381	splice site	silent
R6364:Sp3	UTSW	2	72970941	missense	probably benign	0.00
R6640:Sp3	UTSW	2	72971114	missense	possibly damaging	0.61
R7197:Sp3	UTSW	2	72979609	missense	probably benign	0.08
R7699:Sp3	UTSW	2	72971229	missense	probably benign
R8004:Sp3	UTSW	2	72970208	missense	possibly damaging	0.52
R8467:Sp3	UTSW	2	72971138	missense	possibly damaging	0.94
R8503:Sp3	UTSW	2	72938301	missense	probably benign	0.05
R8861:Sp3	UTSW	2	72971286	missense	probably damaging	1.00
Z1176:Sp3	UTSW	2	72970167	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- GCCCACTAGTAGTAGTCAAGC -3'
(R):5'- CTTACTCGCCTCTGGAACAC -3'

Sequencing Primer
(F):5'- CCCACTAGTAGTAGTCAAGCTATTTG -3'
(R):5'- TGGAACACCTCCTGCTAATATC -3'

Posted On

2015-10-08