Mutagenetix > Incidental Mutation

Incidental Mutation 'R4668:Abca4'

352127

Institutional Source

Beutler Lab

Gene Symbol

Abca4

Ensembl Gene

ENSMUSG00000028125

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 4

Synonyms

D430003I15Rik, Abc10, Rim protein, RmP

Accession Numbers

Genbank: NM_007378; MGI: 109424

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4668 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122044443-122180123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 122155299 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 531 (G531E)

Ref Sequence

ENSEMBL: ENSMUSP00000143560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013995] [ENSMUST00000141135]

AlphaFold

O35600

Predicted Effect

possibly damaging
Transcript: ENSMUST00000013995
AA Change: G1739E

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: G1739E

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	608	856	5e-17	PFAM
AAA	955	1145	9.42e-13	SMART
transmembrane domain	1372	1394	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1522	1894	2.9e-44	PFAM
AAA	1963	2147	7.09e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141135
AA Change: G531E

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000143560
Gene: ENSMUSG00000028125
AA Change: G531E

Domain	Start	End	E-Value	Type
Blast:AAA	1	172	9e-78	BLAST
Pfam:ABC2_membrane_3	311	686	1.9e-42	PFAM
AAA	755	939	1.2e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198484

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	A	T	9: 114,304,711		noncoding transcript	Het
6430548M08Rik	T	C	8: 120,160,414		probably null	Het
Acad8	A	G	9: 26,990,627	L147P	probably damaging	Het
Acot10	T	C	15: 20,665,942	S238G	probably benign	Het
Adamtsl2	A	T	2: 27,095,475	H457L	probably benign	Het
Ankrd35	A	T	3: 96,679,208	T67S	probably damaging	Het
Aox2	T	G	1: 58,334,694	I838S	possibly damaging	Het
Arnt2	T	C	7: 84,275,386	N411S	probably damaging	Het
Bmpr2	T	C	1: 59,867,716	L656S	probably damaging	Het
Carns1	A	T	19: 4,165,476	Y902*	probably null	Het
Cavin1	T	C	11: 100,958,796	E336G	probably damaging	Het
Cbl	A	T	9: 44,153,848	C728S	probably benign	Het
Ccdc136	C	A	6: 29,411,281	Q218K	probably damaging	Het
Cdk19	C	A	10: 40,466,710	T196K	probably damaging	Het
Ceacam20	T	C	7: 19,986,027	Y495H	probably damaging	Het
Celf2	T	C	2: 6,721,528	I47V	probably benign	Het
Ces3a	A	C	8: 105,053,423	K299T	probably damaging	Het
Cfap61	A	T	2: 146,143,136	I967F	probably damaging	Het
Cnksr1	C	T	4: 134,232,971		probably benign	Het
Cped1	T	C	6: 22,237,653	Y923H	probably benign	Het
Crip3	T	C	17: 46,429,364	L30P	probably damaging	Het
Csmd1	A	G	8: 16,023,891	I2030T	possibly damaging	Het
Ctse	C	A	1: 131,662,749	P70T	probably damaging	Het
Cyp2b23	A	G	7: 26,672,734	F429L	probably damaging	Het
Cyp2c66	T	A	19: 39,176,656	D360E	probably damaging	Het
D8Ertd738e	A	T	8: 84,249,481	L46*	probably null	Het
Dcp2	T	A	18: 44,415,362		probably null	Het
Ddx10	C	A	9: 53,099,213	D834Y	possibly damaging	Het
Ddx19a	A	T	8: 110,979,084	V245E	probably damaging	Het
Dpf2	A	C	19: 5,904,487	D130E	probably benign	Het
Emc8	A	T	8: 120,667,779	M67K	probably damaging	Het
Ephb6	T	C	6: 41,614,602	L231P	possibly damaging	Het
Erp27	T	C	6: 136,908,152	E216G	possibly damaging	Het
Esco1	A	T	18: 10,594,734	I184N	possibly damaging	Het
Fam205c	A	G	4: 42,871,608	F256L	probably benign	Het
Fdxacb1	T	A	9: 50,770,260	D11E	possibly damaging	Het
Fhod3	C	T	18: 25,066,338	P689S	probably benign	Het
Fnip1	T	A	11: 54,503,559	S940R	probably damaging	Het
Ganc	G	T	2: 120,431,067	V343F	probably benign	Het
Gldn	T	A	9: 54,332,018	L228*	probably null	Het
Gm1123	C	T	9: 99,009,373	R341H	probably damaging	Het
Gtf2f2	T	C	14: 75,917,638	Y161C	probably benign	Het
Gtf3c1	T	C	7: 125,667,338	T979A	probably damaging	Het
Hist1h4a	A	G	13: 23,760,976	V61A	probably benign	Het
Hmcn2	G	T	2: 31,435,792	R4277L	probably benign	Het
Hsd17b6	T	A	10: 127,994,426		probably null	Het
Igkv12-46	T	C	6: 69,764,797	T25A	probably damaging	Het
Inpp5e	G	A	2: 26,400,994	R354C	probably damaging	Het
Jcad	T	A	18: 4,680,221		probably null	Het
Kcna10	G	T	3: 107,194,694	A214S	possibly damaging	Het
Kit	T	C	5: 75,641,220		probably null	Het
Kmt2a	G	A	9: 44,824,572		probably benign	Het
Lama1	T	C	17: 67,752,434	V604A	probably benign	Het
Mesd	T	C	7: 83,895,756	V138A	probably damaging	Het
Mmp13	T	C	9: 7,272,580	F9S	possibly damaging	Het
Mocos	T	C	18: 24,666,434	Y242H	probably benign	Het
Mrc1	A	C	2: 14,293,486	T718P	probably damaging	Het
Msh6	T	C	17: 87,984,806	S330P	possibly damaging	Het
Myh10	A	G	11: 68,804,642	K1532E	probably damaging	Het
Nat9	T	C	11: 115,184,542	N91S	probably damaging	Het
Neto2	A	T	8: 85,641,062	I351N	probably damaging	Het
Nfx1	A	G	4: 40,976,367	N14D	possibly damaging	Het
Nlrp4b	A	G	7: 10,714,733	T288A	possibly damaging	Het
Nutm2	C	A	13: 50,472,997	T396K	probably benign	Het
Ogdhl	A	G	14: 32,332,536	T196A	probably benign	Het
Olfr1453	A	T	19: 13,028,081	F83I	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,604	I223V	possibly damaging	Het
Olfr582	A	T	7: 103,041,851	D119V	probably benign	Het
Omg	T	A	11: 79,502,423	N203I	probably damaging	Het
Pdgfrb	A	G	18: 61,064,113	Y207C	probably damaging	Het
Pdzd7	T	A	19: 45,045,687		probably benign	Het
Pgs1	C	A	11: 118,003,507	H157N	probably damaging	Het
Pik3c2a	A	G	7: 116,358,688	V1121A	probably benign	Het
Pikfyve	T	A	1: 65,250,273	C1235S	probably damaging	Het
Pms1	G	A	1: 53,189,474	Q872*	probably null	Het
Ptgs2	A	G	1: 150,101,084	T23A	probably benign	Het
Rgl1	T	G	1: 152,521,371	R716S	probably damaging	Het
Rif1	A	G	2: 52,111,952	E1806G	probably benign	Het
Ripor1	T	C	8: 105,614,652	V39A	probably benign	Het
Ryr2	G	T	13: 11,593,117	T868N	probably benign	Het
Sec22b	A	T	3: 97,921,122	D167V	probably damaging	Het
Sec24d	T	C	3: 123,355,774	V810A	probably damaging	Het
Shh	T	C	5: 28,457,855	*438W	probably null	Het
Slc25a12	G	A	2: 71,315,062	S178L	probably benign	Het
Sorl1	A	T	9: 41,984,508	W1784R	probably damaging	Het
Sp3	A	T	2: 72,970,981	S229R	probably damaging	Het
Spdye4c	G	A	2: 128,592,353	V5I	possibly damaging	Het
Spint2	A	T	7: 29,260,379	V53D	probably damaging	Het
Stard3nl	T	A	13: 19,376,519	N29Y	probably damaging	Het
Stk25	A	G	1: 93,625,483	S299P	probably damaging	Het
Sult2a3	A	G	7: 14,122,861	S45P	probably damaging	Het
Thsd7a	A	T	6: 12,408,968	V685E	probably damaging	Het
Tm9sf4	T	A	2: 153,187,308	V92D	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Topors	G	A	4: 40,262,669	T205I	probably damaging	Het
Tpo	T	A	12: 30,103,290	Y355F	probably benign	Het
Uba1y	T	A	Y: 826,032	M396K	possibly damaging	Het
Vmn1r50	A	T	6: 90,107,531	Q86L	probably benign	Het
Vmn1r77	A	G	7: 12,041,431	K45E	probably damaging	Het
Vmn2r114	A	C	17: 23,310,473	N218K	possibly damaging	Het
Vmn2r66	T	A	7: 84,994,697	N835I	probably damaging	Het
Vps54	T	G	11: 21,299,989	N458K	probably benign	Het
Zcchc7	G	T	4: 44,895,964	C304F	probably damaging	Het
Zfp335	A	T	2: 164,900,286	C593S	probably damaging	Het
Zmynd15	C	G	11: 70,462,588	P214R	probably damaging	Het

Other mutations in Abca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Abca4	APN	3	122062704	splice site	probably null
IGL00229:Abca4	APN	3	122170954	missense	probably damaging	1.00
IGL00858:Abca4	APN	3	122173888	missense	probably damaging	0.97
IGL01316:Abca4	APN	3	122141755	missense	probably damaging	0.99
IGL01357:Abca4	APN	3	122103583	missense	probably damaging	1.00
IGL01784:Abca4	APN	3	122138505	missense	probably benign	0.22
IGL01903:Abca4	APN	3	122155401	splice site	probably benign
IGL02008:Abca4	APN	3	122176101	missense	probably benign	0.00
IGL02113:Abca4	APN	3	122110478	missense	possibly damaging	0.90
IGL02142:Abca4	APN	3	122169926	missense	probably benign	0.01
IGL02200:Abca4	APN	3	122069014	missense	probably benign	0.00
IGL02203:Abca4	APN	3	122179808	missense	probably benign
IGL02306:Abca4	APN	3	122158395	missense	probably damaging	1.00
IGL02307:Abca4	APN	3	122141746	missense	probably damaging	1.00
IGL02673:Abca4	APN	3	122103501	missense	probably damaging	1.00
IGL02864:Abca4	APN	3	122143431	missense	probably damaging	1.00
IGL02886:Abca4	APN	3	122128214	missense	probably damaging	0.96
IGL02934:Abca4	APN	3	122162359	nonsense	probably null
IGL02992:Abca4	APN	3	122128286	missense	probably damaging	0.96
IGL03083:Abca4	APN	3	122138612	critical splice donor site	probably null
IGL03258:Abca4	APN	3	122137561	splice site	probably benign
IGL03279:Abca4	APN	3	122141732	missense	probably benign	0.12
3-1:Abca4	UTSW	3	122080925	missense	probably benign	0.01
B6819:Abca4	UTSW	3	122103624	splice site	probably benign
K7894:Abca4	UTSW	3	122147868	frame shift	probably null
PIT4151001:Abca4	UTSW	3	122137021	missense	probably damaging	0.99
PIT4453001:Abca4	UTSW	3	122105316	missense	probably damaging	0.99
R0001:Abca4	UTSW	3	122081011	splice site	probably benign
R0091:Abca4	UTSW	3	122138530	missense	possibly damaging	0.94
R0138:Abca4	UTSW	3	122105449	missense	probably damaging	1.00
R0344:Abca4	UTSW	3	122083964	missense	probably damaging	1.00
R0347:Abca4	UTSW	3	122120099	missense	probably benign	0.00
R0508:Abca4	UTSW	3	122123551	splice site	probably benign
R0607:Abca4	UTSW	3	122156432	missense	probably damaging	1.00
R0835:Abca4	UTSW	3	122126213	missense	probably damaging	1.00
R0839:Abca4	UTSW	3	122126878	missense	probably damaging	0.99
R1138:Abca4	UTSW	3	122173848	missense	probably benign	0.13
R1448:Abca4	UTSW	3	122162928	splice site	probably null
R1453:Abca4	UTSW	3	122069114	missense	probably benign	0.04
R1533:Abca4	UTSW	3	122135158	missense	probably benign	0.07
R1645:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R1763:Abca4	UTSW	3	122110681	missense	probably benign	0.09
R1763:Abca4	UTSW	3	122163830	missense	probably damaging	1.00
R1838:Abca4	UTSW	3	122128305	missense	probably benign
R1867:Abca4	UTSW	3	122105361	missense	probably damaging	1.00
R1907:Abca4	UTSW	3	122069012	missense	probably damaging	0.99
R1935:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R1936:Abca4	UTSW	3	122052923	missense	probably benign	0.00
R2165:Abca4	UTSW	3	122112399	missense	possibly damaging	0.90
R2391:Abca4	UTSW	3	122158422	missense	probably benign	0.00
R2403:Abca4	UTSW	3	122170943	missense	probably damaging	1.00
R3788:Abca4	UTSW	3	122052912	missense	possibly damaging	0.50
R3814:Abca4	UTSW	3	122170921	splice site	probably benign
R4554:Abca4	UTSW	3	122156343	missense	possibly damaging	0.91
R4649:Abca4	UTSW	3	122169893	missense	probably damaging	1.00
R4653:Abca4	UTSW	3	122138581	nonsense	probably null
R4655:Abca4	UTSW	3	122147498	missense	possibly damaging	0.93
R4705:Abca4	UTSW	3	122105370	missense	probably damaging	0.98
R4788:Abca4	UTSW	3	122166712	missense	probably damaging	1.00
R4795:Abca4	UTSW	3	122176123	missense	probably damaging	0.99
R4999:Abca4	UTSW	3	122105370	missense	probably damaging	1.00
R5301:Abca4	UTSW	3	122102853	missense	probably damaging	0.96
R5372:Abca4	UTSW	3	122055339	missense	probably damaging	0.96
R5395:Abca4	UTSW	3	122080941	missense	probably benign	0.00
R5539:Abca4	UTSW	3	122169908	missense	probably damaging	1.00
R5583:Abca4	UTSW	3	122148901	missense	probably damaging	0.99
R5706:Abca4	UTSW	3	122054261	missense	probably benign	0.10
R5719:Abca4	UTSW	3	122135266	critical splice donor site	probably null
R5731:Abca4	UTSW	3	122132593	missense	probably damaging	1.00
R5802:Abca4	UTSW	3	122054232	missense	probably damaging	1.00
R5819:Abca4	UTSW	3	122136981	missense	probably damaging	0.97
R5853:Abca4	UTSW	3	122103531	missense	probably benign
R6053:Abca4	UTSW	3	122171017	missense	probably damaging	0.99
R6135:Abca4	UTSW	3	122138447	missense	possibly damaging	0.69
R6185:Abca4	UTSW	3	122126140	missense	probably damaging	0.97
R6227:Abca4	UTSW	3	122137094	nonsense	probably null
R6293:Abca4	UTSW	3	122141746	missense	probably damaging	1.00
R6297:Abca4	UTSW	3	122132530	missense	probably benign	0.24
R6367:Abca4	UTSW	3	122103580	missense	probably damaging	1.00
R6376:Abca4	UTSW	3	122123660	missense	possibly damaging	0.95
R6405:Abca4	UTSW	3	122173662	splice site	probably null
R6525:Abca4	UTSW	3	122137659	missense	probably benign	0.00
R6602:Abca4	UTSW	3	122138501	missense	probably benign	0.00
R6681:Abca4	UTSW	3	122121798	missense	probably damaging	1.00
R6747:Abca4	UTSW	3	122126313	splice site	probably null
R6852:Abca4	UTSW	3	122135195	missense	probably damaging	0.99
R7049:Abca4	UTSW	3	122147848	missense	probably benign	0.00
R7072:Abca4	UTSW	3	122173943	missense	probably damaging	1.00
R7092:Abca4	UTSW	3	122138569	missense	probably damaging	1.00
R7110:Abca4	UTSW	3	122132643	missense	probably damaging	1.00
R7138:Abca4	UTSW	3	122105464	nonsense	probably null
R7172:Abca4	UTSW	3	122103540	nonsense	probably null
R7263:Abca4	UTSW	3	122054194	missense	probably damaging	0.99
R7414:Abca4	UTSW	3	122102738	missense	probably benign	0.28
R7537:Abca4	UTSW	3	122173988	missense	possibly damaging	0.68
R7577:Abca4	UTSW	3	122174014	missense	probably damaging	1.00
R7665:Abca4	UTSW	3	122044490	start gained	probably benign
R7758:Abca4	UTSW	3	122128167	missense	probably damaging	1.00
R7935:Abca4	UTSW	3	122110537	missense	possibly damaging	0.85
R8237:Abca4	UTSW	3	122162303	missense	probably benign	0.00
R8255:Abca4	UTSW	3	122155277	missense	probably benign	0.00
R8294:Abca4	UTSW	3	122103568	missense	possibly damaging	0.75
R8504:Abca4	UTSW	3	122129334	missense	probably benign	0.01
R8536:Abca4	UTSW	3	122179745	missense	probably benign	0.01
R8714:Abca4	UTSW	3	122148879	missense	probably benign	0.19
R8771:Abca4	UTSW	3	122086671	missense	probably damaging	0.97
R8835:Abca4	UTSW	3	122102784	missense	probably benign	0.00
R8845:Abca4	UTSW	3	122137002	missense	probably damaging	1.00
R8856:Abca4	UTSW	3	122112447	missense	probably benign
R8933:Abca4	UTSW	3	122128137	missense	probably damaging	1.00
R9052:Abca4	UTSW	3	122147259	missense	possibly damaging	0.68
R9095:Abca4	UTSW	3	122173907	missense	possibly damaging	0.52
R9221:Abca4	UTSW	3	122128179	missense	probably damaging	1.00
R9262:Abca4	UTSW	3	122170990	missense	probably damaging	1.00
R9301:Abca4	UTSW	3	122087479	missense	probably benign	0.24
R9367:Abca4	UTSW	3	122044548	start codon destroyed	probably null	0.99
R9408:Abca4	UTSW	3	122137625	missense	probably benign
R9425:Abca4	UTSW	3	122132695	missense	probably damaging	1.00
R9464:Abca4	UTSW	3	122120065	missense	probably benign	0.08
R9483:Abca4	UTSW	3	122085626	missense
R9751:Abca4	UTSW	3	122087477	missense	probably benign	0.00
Z1176:Abca4	UTSW	3	122103488	missense	probably damaging	1.00
Z1176:Abca4	UTSW	3	122156443	missense	probably damaging	1.00
Z1177:Abca4	UTSW	3	122147786	missense	possibly damaging	0.79
Z1177:Abca4	UTSW	3	122173914	missense	probably benign	0.21
Z1189:Abca4	UTSW	3	122083993	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TCTTTTCCAAAGATACAGGACTGG -3'
(R):5'- TGCCTGCGCTACCAGTATAAG -3'

Sequencing Primer
(F):5'- TACAGGACTGGAGGTCTTTGAAC -3'
(R):5'- GTATAAGACAACCCAAGTTTGCCGTC -3'

Posted On

2015-10-08