Mutagenetix > Incidental Mutation

Incidental Mutation 'R4668:Thsd7a'

352136

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4668 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12311610-12749410 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12408968 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 685 (V685E)

Ref Sequence

ENSEMBL: ENSMUSP00000131662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000119581
AA Change: V685E

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: V685E

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122369

SMART Domains

Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	43	100	6.24e-6	SMART
TSP1	178	228	7.31e-2	SMART
Blast:TSP1	232	302	4e-26	BLAST
TSP1	307	362	9.09e-8	SMART
TSP1	365	430	5.82e-1	SMART
TSP1	435	487	4.24e-2	SMART
TSP1	490	551	1e0	SMART
TSP1	556	608	3.55e-10	SMART
TSP1	609	679	7.5e-2	SMART
TSP1	684	742	1.55e-1	SMART
transmembrane domain	874	896	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172356
AA Change: V685E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: V685E

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	A	T	9: 114,304,711		noncoding transcript	Het
6430548M08Rik	T	C	8: 120,160,414		probably null	Het
Abca4	G	A	3: 122,155,299	G531E	possibly damaging	Het
Acad8	A	G	9: 26,990,627	L147P	probably damaging	Het
Acot10	T	C	15: 20,665,942	S238G	probably benign	Het
Adamtsl2	A	T	2: 27,095,475	H457L	probably benign	Het
Ankrd35	A	T	3: 96,679,208	T67S	probably damaging	Het
Aox2	T	G	1: 58,334,694	I838S	possibly damaging	Het
Arnt2	T	C	7: 84,275,386	N411S	probably damaging	Het
Bmpr2	T	C	1: 59,867,716	L656S	probably damaging	Het
Carns1	A	T	19: 4,165,476	Y902*	probably null	Het
Cavin1	T	C	11: 100,958,796	E336G	probably damaging	Het
Cbl	A	T	9: 44,153,848	C728S	probably benign	Het
Ccdc136	C	A	6: 29,411,281	Q218K	probably damaging	Het
Cdk19	C	A	10: 40,466,710	T196K	probably damaging	Het
Ceacam20	T	C	7: 19,986,027	Y495H	probably damaging	Het
Celf2	T	C	2: 6,721,528	I47V	probably benign	Het
Ces3a	A	C	8: 105,053,423	K299T	probably damaging	Het
Cfap61	A	T	2: 146,143,136	I967F	probably damaging	Het
Cnksr1	C	T	4: 134,232,971		probably benign	Het
Cped1	T	C	6: 22,237,653	Y923H	probably benign	Het
Crip3	T	C	17: 46,429,364	L30P	probably damaging	Het
Csmd1	A	G	8: 16,023,891	I2030T	possibly damaging	Het
Ctse	C	A	1: 131,662,749	P70T	probably damaging	Het
Cyp2b23	A	G	7: 26,672,734	F429L	probably damaging	Het
Cyp2c66	T	A	19: 39,176,656	D360E	probably damaging	Het
D8Ertd738e	A	T	8: 84,249,481	L46*	probably null	Het
Dcp2	T	A	18: 44,415,362		probably null	Het
Ddx10	C	A	9: 53,099,213	D834Y	possibly damaging	Het
Ddx19a	A	T	8: 110,979,084	V245E	probably damaging	Het
Dpf2	A	C	19: 5,904,487	D130E	probably benign	Het
Emc8	A	T	8: 120,667,779	M67K	probably damaging	Het
Ephb6	T	C	6: 41,614,602	L231P	possibly damaging	Het
Erp27	T	C	6: 136,908,152	E216G	possibly damaging	Het
Esco1	A	T	18: 10,594,734	I184N	possibly damaging	Het
Fam205c	A	G	4: 42,871,608	F256L	probably benign	Het
Fdxacb1	T	A	9: 50,770,260	D11E	possibly damaging	Het
Fhod3	C	T	18: 25,066,338	P689S	probably benign	Het
Fnip1	T	A	11: 54,503,559	S940R	probably damaging	Het
Ganc	G	T	2: 120,431,067	V343F	probably benign	Het
Gldn	T	A	9: 54,332,018	L228*	probably null	Het
Gm1123	C	T	9: 99,009,373	R341H	probably damaging	Het
Gtf2f2	T	C	14: 75,917,638	Y161C	probably benign	Het
Gtf3c1	T	C	7: 125,667,338	T979A	probably damaging	Het
Hist1h4a	A	G	13: 23,760,976	V61A	probably benign	Het
Hmcn2	G	T	2: 31,435,792	R4277L	probably benign	Het
Hsd17b6	T	A	10: 127,994,426		probably null	Het
Igkv12-46	T	C	6: 69,764,797	T25A	probably damaging	Het
Inpp5e	G	A	2: 26,400,994	R354C	probably damaging	Het
Jcad	T	A	18: 4,680,221		probably null	Het
Kcna10	G	T	3: 107,194,694	A214S	possibly damaging	Het
Kit	T	C	5: 75,641,220		probably null	Het
Kmt2a	G	A	9: 44,824,572		probably benign	Het
Lama1	T	C	17: 67,752,434	V604A	probably benign	Het
Mesd	T	C	7: 83,895,756	V138A	probably damaging	Het
Mmp13	T	C	9: 7,272,580	F9S	possibly damaging	Het
Mocos	T	C	18: 24,666,434	Y242H	probably benign	Het
Mrc1	A	C	2: 14,293,486	T718P	probably damaging	Het
Msh6	T	C	17: 87,984,806	S330P	possibly damaging	Het
Myh10	A	G	11: 68,804,642	K1532E	probably damaging	Het
Nat9	T	C	11: 115,184,542	N91S	probably damaging	Het
Neto2	A	T	8: 85,641,062	I351N	probably damaging	Het
Nfx1	A	G	4: 40,976,367	N14D	possibly damaging	Het
Nlrp4b	A	G	7: 10,714,733	T288A	possibly damaging	Het
Nutm2	C	A	13: 50,472,997	T396K	probably benign	Het
Ogdhl	A	G	14: 32,332,536	T196A	probably benign	Het
Olfr1453	A	T	19: 13,028,081	F83I	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,604	I223V	possibly damaging	Het
Olfr582	A	T	7: 103,041,851	D119V	probably benign	Het
Omg	T	A	11: 79,502,423	N203I	probably damaging	Het
Pdgfrb	A	G	18: 61,064,113	Y207C	probably damaging	Het
Pdzd7	T	A	19: 45,045,687		probably benign	Het
Pgs1	C	A	11: 118,003,507	H157N	probably damaging	Het
Pik3c2a	A	G	7: 116,358,688	V1121A	probably benign	Het
Pikfyve	T	A	1: 65,250,273	C1235S	probably damaging	Het
Pms1	G	A	1: 53,189,474	Q872*	probably null	Het
Ptgs2	A	G	1: 150,101,084	T23A	probably benign	Het
Rgl1	T	G	1: 152,521,371	R716S	probably damaging	Het
Rif1	A	G	2: 52,111,952	E1806G	probably benign	Het
Ripor1	T	C	8: 105,614,652	V39A	probably benign	Het
Ryr2	G	T	13: 11,593,117	T868N	probably benign	Het
Sec22b	A	T	3: 97,921,122	D167V	probably damaging	Het
Sec24d	T	C	3: 123,355,774	V810A	probably damaging	Het
Shh	T	C	5: 28,457,855	*438W	probably null	Het
Slc25a12	G	A	2: 71,315,062	S178L	probably benign	Het
Sorl1	A	T	9: 41,984,508	W1784R	probably damaging	Het
Sp3	A	T	2: 72,970,981	S229R	probably damaging	Het
Spdye4c	G	A	2: 128,592,353	V5I	possibly damaging	Het
Spint2	A	T	7: 29,260,379	V53D	probably damaging	Het
Stard3nl	T	A	13: 19,376,519	N29Y	probably damaging	Het
Stk25	A	G	1: 93,625,483	S299P	probably damaging	Het
Sult2a3	A	G	7: 14,122,861	S45P	probably damaging	Het
Tm9sf4	T	A	2: 153,187,308	V92D	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Topors	G	A	4: 40,262,669	T205I	probably damaging	Het
Tpo	T	A	12: 30,103,290	Y355F	probably benign	Het
Uba1y	T	A	Y: 826,032	M396K	possibly damaging	Het
Vmn1r50	A	T	6: 90,107,531	Q86L	probably benign	Het
Vmn1r77	A	G	7: 12,041,431	K45E	probably damaging	Het
Vmn2r114	A	C	17: 23,310,473	N218K	possibly damaging	Het
Vmn2r66	T	A	7: 84,994,697	N835I	probably damaging	Het
Vps54	T	G	11: 21,299,989	N458K	probably benign	Het
Zcchc7	G	T	4: 44,895,964	C304F	probably damaging	Het
Zfp335	A	T	2: 164,900,286	C593S	probably damaging	Het
Zmynd15	C	G	11: 70,462,588	P214R	probably damaging	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12379659	splice site	probably null
IGL00563:Thsd7a	APN	6	12379659	splice site	probably null
IGL00753:Thsd7a	APN	6	12327529	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12554934	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12471080	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12554981	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12504099	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12317419	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12331006	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12555258	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02361:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02375:Thsd7a	APN	6	12343265	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12318171	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12408985	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12321072	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12500995	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12324681	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12343178	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12504168	splice site	probably benign
IGL03337:Thsd7a	APN	6	12405174	missense	probably damaging	1.00
G1patch:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
PIT4354001:Thsd7a	UTSW	6	12331927	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12320970	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12554908	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12418335	missense	probably damaging	1.00
R0226:Thsd7a	UTSW	6	12321900	missense	possibly damaging	0.94
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12352031	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12321887	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12379594	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12379605	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12331542	splice site	probably null
R0577:Thsd7a	UTSW	6	12321048	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12331542	splice site	probably null
R0755:Thsd7a	UTSW	6	12555369	missense	probably damaging	1.00
R0771:Thsd7a	UTSW	6	12327577	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0873:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R1102:Thsd7a	UTSW	6	12555702	missense	possibly damaging	0.58
R1144:Thsd7a	UTSW	6	12471027	splice site	probably benign
R1265:Thsd7a	UTSW	6	12317419	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12418370	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12555439	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12338622	missense	probably benign	0.08
R1519:Thsd7a	UTSW	6	12471175	missense	probably benign	0.01
R1633:Thsd7a	UTSW	6	12471104	nonsense	probably null
R1659:Thsd7a	UTSW	6	12504064	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12555715	nonsense	probably null
R1824:Thsd7a	UTSW	6	12409042	splice site	probably null
R1840:Thsd7a	UTSW	6	12330974	missense	probably benign	0.03
R1845:Thsd7a	UTSW	6	12321041	missense	probably damaging	1.00
R1874:Thsd7a	UTSW	6	12555435	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12327536	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12408923	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12318106	splice site	probably benign
R2138:Thsd7a	UTSW	6	12471073	nonsense	probably null
R2155:Thsd7a	UTSW	6	12379633	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12331944	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12337268	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12405147	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12337362	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12418337	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12331549	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12468908	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12324635	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4664:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4665:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4666:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4886:Thsd7a	UTSW	6	12327660	nonsense	probably null
R4918:Thsd7a	UTSW	6	12327559	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12330992	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12330952	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12338655	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12379583	nonsense	probably null
R5242:Thsd7a	UTSW	6	12327583	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12379602	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12748800	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12332017	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12332007	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12379471	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12343213	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12343148	missense	probably benign	0.00
R5848:Thsd7a	UTSW	6	12503923	missense	probably damaging	1.00
R5958:Thsd7a	UTSW	6	12337262	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12379389	splice site	probably null
R6139:Thsd7a	UTSW	6	12379573	missense	possibly damaging	0.93
R6243:Thsd7a	UTSW	6	12327602	missense	probably damaging	1.00
R6257:Thsd7a	UTSW	6	12408988	nonsense	probably null
R6273:Thsd7a	UTSW	6	12408836	missense	probably damaging	0.99
R6300:Thsd7a	UTSW	6	12471104	nonsense	probably null
R6314:Thsd7a	UTSW	6	12554997	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12468929	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12555082	nonsense	probably null
R6515:Thsd7a	UTSW	6	12501086	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12408816	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12555637	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12504075	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12379430	missense
R7170:Thsd7a	UTSW	6	12352091	missense
R7349:Thsd7a	UTSW	6	12352068	missense
R7460:Thsd7a	UTSW	6	12554934	missense
R7467:Thsd7a	UTSW	6	12331585	missense
R7666:Thsd7a	UTSW	6	12379438	missense
R7869:Thsd7a	UTSW	6	12471124	nonsense	probably null
R8032:Thsd7a	UTSW	6	12555288	missense
R8165:Thsd7a	UTSW	6	12468963	missense
R8167:Thsd7a	UTSW	6	12317401	nonsense	probably null
R8245:Thsd7a	UTSW	6	12379593	missense
R8310:Thsd7a	UTSW	6	12396613	missense
R8312:Thsd7a	UTSW	6	12471182	missense
R8331:Thsd7a	UTSW	6	12471158	missense
R8755:Thsd7a	UTSW	6	12408852	nonsense	probably null
R8843:Thsd7a	UTSW	6	12501137	missense
R8867:Thsd7a	UTSW	6	12338687	missense
R8952:Thsd7a	UTSW	6	12468993	missense	probably damaging	0.98
R9036:Thsd7a	UTSW	6	12418250	missense
R9299:Thsd7a	UTSW	6	12504132	missense
R9366:Thsd7a	UTSW	6	12555481	missense
R9489:Thsd7a	UTSW	6	12352023	missense

Predicted Primers

PCR Primer
(F):5'- TGGCTAACCGCAAGATTTACC -3'
(R):5'- CTATGGGCCTACTGAGTGGTAATC -3'

Sequencing Primer
(F):5'- ACCGCAAGATTTACCACTGTCATTC -3'
(R):5'- GGTAATCGTCATTGTTATCAGCC -3'

Posted On

2015-10-08