Mutagenetix > Incidental Mutation

Incidental Mutation 'R4668:Spint2'

352149

Institutional Source

Beutler Lab

Gene Symbol

Spint2

Ensembl Gene

ENSMUSG00000074227

Gene Name

serine protease inhibitor, Kunitz type 2

Synonyms

HAI-2

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4668 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29256323-29281912 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 29260379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 53 (V53D)

Ref Sequence

ENSEMBL: ENSMUSP00000103871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098604] [ENSMUST00000108236] [ENSMUST00000207601]

AlphaFold

Q9WU03

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098604
AA Change: V110D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000096204
Gene: ENSMUSG00000074227
AA Change: V110D

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
KU	36	89	3.02e-23	SMART
KU	131	184	2.34e-20	SMART
transmembrane domain	198	220	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108236
AA Change: V53D

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103871
Gene: ENSMUSG00000074227
AA Change: V53D

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
KU	74	127	2.34e-20	SMART
transmembrane domain	141	163	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000207601
AA Change: V53D

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208585

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein with two extracellular Kunitz domains that inhibits a variety of serine proteases. The protein inhibits HGF activator which prevents the formation of active hepatocyte growth factor. This gene is a putative tumor suppressor, and mutations in this gene result in congenital sodium diarrhea. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous embryos carrying an insertional mutation fail to progress to the headfold stage and die at gastrulation displaying a severe clefting of the embryonic ectoderm at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	A	T	9: 114,304,711		noncoding transcript	Het
6430548M08Rik	T	C	8: 120,160,414		probably null	Het
Abca4	G	A	3: 122,155,299	G531E	possibly damaging	Het
Acad8	A	G	9: 26,990,627	L147P	probably damaging	Het
Acot10	T	C	15: 20,665,942	S238G	probably benign	Het
Adamtsl2	A	T	2: 27,095,475	H457L	probably benign	Het
Ankrd35	A	T	3: 96,679,208	T67S	probably damaging	Het
Aox2	T	G	1: 58,334,694	I838S	possibly damaging	Het
Arnt2	T	C	7: 84,275,386	N411S	probably damaging	Het
Bmpr2	T	C	1: 59,867,716	L656S	probably damaging	Het
Carns1	A	T	19: 4,165,476	Y902*	probably null	Het
Cavin1	T	C	11: 100,958,796	E336G	probably damaging	Het
Cbl	A	T	9: 44,153,848	C728S	probably benign	Het
Ccdc136	C	A	6: 29,411,281	Q218K	probably damaging	Het
Cdk19	C	A	10: 40,466,710	T196K	probably damaging	Het
Ceacam20	T	C	7: 19,986,027	Y495H	probably damaging	Het
Celf2	T	C	2: 6,721,528	I47V	probably benign	Het
Ces3a	A	C	8: 105,053,423	K299T	probably damaging	Het
Cfap61	A	T	2: 146,143,136	I967F	probably damaging	Het
Cnksr1	C	T	4: 134,232,971		probably benign	Het
Cped1	T	C	6: 22,237,653	Y923H	probably benign	Het
Crip3	T	C	17: 46,429,364	L30P	probably damaging	Het
Csmd1	A	G	8: 16,023,891	I2030T	possibly damaging	Het
Ctse	C	A	1: 131,662,749	P70T	probably damaging	Het
Cyp2b23	A	G	7: 26,672,734	F429L	probably damaging	Het
Cyp2c66	T	A	19: 39,176,656	D360E	probably damaging	Het
D8Ertd738e	A	T	8: 84,249,481	L46*	probably null	Het
Dcp2	T	A	18: 44,415,362		probably null	Het
Ddx10	C	A	9: 53,099,213	D834Y	possibly damaging	Het
Ddx19a	A	T	8: 110,979,084	V245E	probably damaging	Het
Dpf2	A	C	19: 5,904,487	D130E	probably benign	Het
Emc8	A	T	8: 120,667,779	M67K	probably damaging	Het
Ephb6	T	C	6: 41,614,602	L231P	possibly damaging	Het
Erp27	T	C	6: 136,908,152	E216G	possibly damaging	Het
Esco1	A	T	18: 10,594,734	I184N	possibly damaging	Het
Fam205c	A	G	4: 42,871,608	F256L	probably benign	Het
Fdxacb1	T	A	9: 50,770,260	D11E	possibly damaging	Het
Fhod3	C	T	18: 25,066,338	P689S	probably benign	Het
Fnip1	T	A	11: 54,503,559	S940R	probably damaging	Het
Ganc	G	T	2: 120,431,067	V343F	probably benign	Het
Gldn	T	A	9: 54,332,018	L228*	probably null	Het
Gm1123	C	T	9: 99,009,373	R341H	probably damaging	Het
Gtf2f2	T	C	14: 75,917,638	Y161C	probably benign	Het
Gtf3c1	T	C	7: 125,667,338	T979A	probably damaging	Het
Hist1h4a	A	G	13: 23,760,976	V61A	probably benign	Het
Hmcn2	G	T	2: 31,435,792	R4277L	probably benign	Het
Hsd17b6	T	A	10: 127,994,426		probably null	Het
Igkv12-46	T	C	6: 69,764,797	T25A	probably damaging	Het
Inpp5e	G	A	2: 26,400,994	R354C	probably damaging	Het
Jcad	T	A	18: 4,680,221		probably null	Het
Kcna10	G	T	3: 107,194,694	A214S	possibly damaging	Het
Kit	T	C	5: 75,641,220		probably null	Het
Kmt2a	G	A	9: 44,824,572		probably benign	Het
Lama1	T	C	17: 67,752,434	V604A	probably benign	Het
Mesd	T	C	7: 83,895,756	V138A	probably damaging	Het
Mmp13	T	C	9: 7,272,580	F9S	possibly damaging	Het
Mocos	T	C	18: 24,666,434	Y242H	probably benign	Het
Mrc1	A	C	2: 14,293,486	T718P	probably damaging	Het
Msh6	T	C	17: 87,984,806	S330P	possibly damaging	Het
Myh10	A	G	11: 68,804,642	K1532E	probably damaging	Het
Nat9	T	C	11: 115,184,542	N91S	probably damaging	Het
Neto2	A	T	8: 85,641,062	I351N	probably damaging	Het
Nfx1	A	G	4: 40,976,367	N14D	possibly damaging	Het
Nlrp4b	A	G	7: 10,714,733	T288A	possibly damaging	Het
Nutm2	C	A	13: 50,472,997	T396K	probably benign	Het
Ogdhl	A	G	14: 32,332,536	T196A	probably benign	Het
Olfr1453	A	T	19: 13,028,081	F83I	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,604	I223V	possibly damaging	Het
Olfr582	A	T	7: 103,041,851	D119V	probably benign	Het
Omg	T	A	11: 79,502,423	N203I	probably damaging	Het
Pdgfrb	A	G	18: 61,064,113	Y207C	probably damaging	Het
Pdzd7	T	A	19: 45,045,687		probably benign	Het
Pgs1	C	A	11: 118,003,507	H157N	probably damaging	Het
Pik3c2a	A	G	7: 116,358,688	V1121A	probably benign	Het
Pikfyve	T	A	1: 65,250,273	C1235S	probably damaging	Het
Pms1	G	A	1: 53,189,474	Q872*	probably null	Het
Ptgs2	A	G	1: 150,101,084	T23A	probably benign	Het
Rgl1	T	G	1: 152,521,371	R716S	probably damaging	Het
Rif1	A	G	2: 52,111,952	E1806G	probably benign	Het
Ripor1	T	C	8: 105,614,652	V39A	probably benign	Het
Ryr2	G	T	13: 11,593,117	T868N	probably benign	Het
Sec22b	A	T	3: 97,921,122	D167V	probably damaging	Het
Sec24d	T	C	3: 123,355,774	V810A	probably damaging	Het
Shh	T	C	5: 28,457,855	*438W	probably null	Het
Slc25a12	G	A	2: 71,315,062	S178L	probably benign	Het
Sorl1	A	T	9: 41,984,508	W1784R	probably damaging	Het
Sp3	A	T	2: 72,970,981	S229R	probably damaging	Het
Spdye4c	G	A	2: 128,592,353	V5I	possibly damaging	Het
Stard3nl	T	A	13: 19,376,519	N29Y	probably damaging	Het
Stk25	A	G	1: 93,625,483	S299P	probably damaging	Het
Sult2a3	A	G	7: 14,122,861	S45P	probably damaging	Het
Thsd7a	A	T	6: 12,408,968	V685E	probably damaging	Het
Tm9sf4	T	A	2: 153,187,308	V92D	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Topors	G	A	4: 40,262,669	T205I	probably damaging	Het
Tpo	T	A	12: 30,103,290	Y355F	probably benign	Het
Uba1y	T	A	Y: 826,032	M396K	possibly damaging	Het
Vmn1r50	A	T	6: 90,107,531	Q86L	probably benign	Het
Vmn1r77	A	G	7: 12,041,431	K45E	probably damaging	Het
Vmn2r114	A	C	17: 23,310,473	N218K	possibly damaging	Het
Vmn2r66	T	A	7: 84,994,697	N835I	probably damaging	Het
Vps54	T	G	11: 21,299,989	N458K	probably benign	Het
Zcchc7	G	T	4: 44,895,964	C304F	probably damaging	Het
Zfp335	A	T	2: 164,900,286	C593S	probably damaging	Het
Zmynd15	C	G	11: 70,462,588	P214R	probably damaging	Het

Other mutations in Spint2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03373:Spint2	APN	7	29258209	splice site	probably benign
R1754:Spint2	UTSW	7	29260366	splice site	probably null
R1992:Spint2	UTSW	7	29259408	missense	probably damaging	1.00
R4172:Spint2	UTSW	7	29263672	missense	probably damaging	0.99
R4852:Spint2	UTSW	7	29256786	missense	probably benign	0.25
R5299:Spint2	UTSW	7	29263726	missense	probably damaging	1.00
R6501:Spint2	UTSW	7	29263706	missense	probably damaging	1.00
R6746:Spint2	UTSW	7	29259423	missense	probably benign	0.01
R7604:Spint2	UTSW	7	29258519	missense	probably damaging	1.00
R8038:Spint2	UTSW	7	29260129	intron	probably benign
R8734:Spint2	UTSW	7	29259410	missense	probably damaging	0.97
Z1176:Spint2	UTSW	7	29256822	missense	possibly damaging	0.61
Z1177:Spint2	UTSW	7	29263660	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGCAGAGAACAAAGGACTTC -3'
(R):5'- AGCCCTGACAGTGCAAAGTC -3'

Sequencing Primer
(F):5'- TGGCAGAGAACAAAGGACTTCTAGAG -3'
(R):5'- TTCTAAGTAAAAAGCTTGCCATGCCC -3'

Posted On

2015-10-08