Incidental Mutation 'R4668:Pik3c2a'
ID 352155
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms PI3KC2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4668 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 115936500-116042684 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115957923 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1121 (V1121A)
Ref Sequence ENSEMBL: ENSMUSP00000146181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000170430
AA Change: V1121A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: V1121A

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206219
AA Change: V1121A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect unknown
Transcript: ENSMUST00000206385
AA Change: V284A
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A T 9: 114,133,779 (GRCm39) noncoding transcript Het
6430548M08Rik T C 8: 120,887,153 (GRCm39) probably null Het
Abca4 G A 3: 121,948,948 (GRCm39) G531E possibly damaging Het
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Acot10 T C 15: 20,666,028 (GRCm39) S238G probably benign Het
Adamtsl2 A T 2: 26,985,487 (GRCm39) H457L probably benign Het
Ankrd35 A T 3: 96,586,524 (GRCm39) T67S probably damaging Het
Aox1 T G 1: 58,373,853 (GRCm39) I838S possibly damaging Het
Arnt2 T C 7: 83,924,594 (GRCm39) N411S probably damaging Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Carns1 A T 19: 4,215,475 (GRCm39) Y902* probably null Het
Cavin1 T C 11: 100,849,622 (GRCm39) E336G probably damaging Het
Cbl A T 9: 44,065,145 (GRCm39) C728S probably benign Het
Ccdc136 C A 6: 29,411,280 (GRCm39) Q218K probably damaging Het
Cdk19 C A 10: 40,342,706 (GRCm39) T196K probably damaging Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Ces3a A C 8: 105,780,055 (GRCm39) K299T probably damaging Het
Cfap61 A T 2: 145,985,056 (GRCm39) I967F probably damaging Het
Cnksr1 C T 4: 133,960,282 (GRCm39) probably benign Het
Cped1 T C 6: 22,237,652 (GRCm39) Y923H probably benign Het
Crip3 T C 17: 46,740,290 (GRCm39) L30P probably damaging Het
Csmd1 A G 8: 16,073,905 (GRCm39) I2030T possibly damaging Het
Ctse C A 1: 131,590,487 (GRCm39) P70T probably damaging Het
Cyp2b23 A G 7: 26,372,159 (GRCm39) F429L probably damaging Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
D8Ertd738e A T 8: 84,976,110 (GRCm39) L46* probably null Het
Dcp2 T A 18: 44,548,429 (GRCm39) probably null Het
Ddx10 C A 9: 53,010,513 (GRCm39) D834Y possibly damaging Het
Ddx19a A T 8: 111,705,716 (GRCm39) V245E probably damaging Het
Dpf2 A C 19: 5,954,515 (GRCm39) D130E probably benign Het
Emc8 A T 8: 121,394,518 (GRCm39) M67K probably damaging Het
Ephb6 T C 6: 41,591,536 (GRCm39) L231P possibly damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
Esco1 A T 18: 10,594,734 (GRCm39) I184N possibly damaging Het
Fdxacb1 T A 9: 50,681,560 (GRCm39) D11E possibly damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnip1 T A 11: 54,394,385 (GRCm39) S940R probably damaging Het
Ganc G T 2: 120,261,548 (GRCm39) V343F probably benign Het
Gldn T A 9: 54,239,302 (GRCm39) L228* probably null Het
Gm1123 C T 9: 98,891,426 (GRCm39) R341H probably damaging Het
Gtf2f2 T C 14: 76,155,078 (GRCm39) Y161C probably benign Het
Gtf3c1 T C 7: 125,266,510 (GRCm39) T979A probably damaging Het
H4c1 A G 13: 23,944,959 (GRCm39) V61A probably benign Het
Hmcn2 G T 2: 31,325,804 (GRCm39) R4277L probably benign Het
Hsd17b6 T A 10: 127,830,295 (GRCm39) probably null Het
Igkv12-46 T C 6: 69,741,781 (GRCm39) T25A probably damaging Het
Inpp5e G A 2: 26,291,006 (GRCm39) R354C probably damaging Het
Jcad T A 18: 4,680,221 (GRCm39) probably null Het
Kcna10 G T 3: 107,102,010 (GRCm39) A214S possibly damaging Het
Kit T C 5: 75,801,880 (GRCm39) probably null Het
Kmt2a G A 9: 44,735,869 (GRCm39) probably benign Het
Lama1 T C 17: 68,059,429 (GRCm39) V604A probably benign Het
Mesd T C 7: 83,544,964 (GRCm39) V138A probably damaging Het
Mmp13 T C 9: 7,272,580 (GRCm39) F9S possibly damaging Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Mrc1 A C 2: 14,298,297 (GRCm39) T718P probably damaging Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Myh10 A G 11: 68,695,468 (GRCm39) K1532E probably damaging Het
Nat9 T C 11: 115,075,368 (GRCm39) N91S probably damaging Het
Neto2 A T 8: 86,367,691 (GRCm39) I351N probably damaging Het
Nfx1 A G 4: 40,976,367 (GRCm39) N14D possibly damaging Het
Nlrp4b A G 7: 10,448,660 (GRCm39) T288A possibly damaging Het
Nutm2 C A 13: 50,627,033 (GRCm39) T396K probably benign Het
Ogdhl A G 14: 32,054,493 (GRCm39) T196A probably benign Het
Omg T A 11: 79,393,249 (GRCm39) N203I probably damaging Het
Or52b4i A G 7: 102,191,811 (GRCm39) I223V possibly damaging Het
Or52r1b A T 7: 102,691,058 (GRCm39) D119V probably benign Het
Or5b101 A T 19: 13,005,445 (GRCm39) F83I probably benign Het
Pdgfrb A G 18: 61,197,185 (GRCm39) Y207C probably damaging Het
Pdzd7 T A 19: 45,034,126 (GRCm39) probably benign Het
Pgs1 C A 11: 117,894,333 (GRCm39) H157N probably damaging Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Pms1 G A 1: 53,228,633 (GRCm39) Q872* probably null Het
Ptgs2 A G 1: 149,976,835 (GRCm39) T23A probably benign Het
Rgl1 T G 1: 152,397,122 (GRCm39) R716S probably damaging Het
Rif1 A G 2: 52,001,964 (GRCm39) E1806G probably benign Het
Ripor1 T C 8: 106,341,284 (GRCm39) V39A probably benign Het
Ryr2 G T 13: 11,608,003 (GRCm39) T868N probably benign Het
Sec22b A T 3: 97,828,438 (GRCm39) D167V probably damaging Het
Sec24d T C 3: 123,149,423 (GRCm39) V810A probably damaging Het
Shh T C 5: 28,662,853 (GRCm39) *438W probably null Het
Slc25a12 G A 2: 71,145,406 (GRCm39) S178L probably benign Het
Sorl1 A T 9: 41,895,804 (GRCm39) W1784R probably damaging Het
Sp3 A T 2: 72,801,325 (GRCm39) S229R probably damaging Het
Spata31f3 A G 4: 42,871,608 (GRCm39) F256L probably benign Het
Spdye4c G A 2: 128,434,273 (GRCm39) V5I possibly damaging Het
Spint2 A T 7: 28,959,804 (GRCm39) V53D probably damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Stk25 A G 1: 93,553,205 (GRCm39) S299P probably damaging Het
Sult2a3 A G 7: 13,856,786 (GRCm39) S45P probably damaging Het
Thsd7a A T 6: 12,408,967 (GRCm39) V685E probably damaging Het
Tm9sf4 T A 2: 153,029,228 (GRCm39) V92D probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Topors G A 4: 40,262,669 (GRCm39) T205I probably damaging Het
Tpo T A 12: 30,153,289 (GRCm39) Y355F probably benign Het
Uba1y T A Y: 826,032 (GRCm39) M396K possibly damaging Het
Vmn1r50 A T 6: 90,084,513 (GRCm39) Q86L probably benign Het
Vmn1r77 A G 7: 11,775,358 (GRCm39) K45E probably damaging Het
Vmn2r114 A C 17: 23,529,447 (GRCm39) N218K possibly damaging Het
Vmn2r66 T A 7: 84,643,905 (GRCm39) N835I probably damaging Het
Vps54 T G 11: 21,249,989 (GRCm39) N458K probably benign Het
Zcchc7 G T 4: 44,895,964 (GRCm39) C304F probably damaging Het
Zfp335 A T 2: 164,742,206 (GRCm39) C593S probably damaging Het
Zmynd15 C G 11: 70,353,414 (GRCm39) P214R probably damaging Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 115,975,518 (GRCm39) missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 115,963,735 (GRCm39) missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 115,973,038 (GRCm39) missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116,017,429 (GRCm39) missense probably benign 0.01
IGL01462:Pik3c2a APN 7 115,975,485 (GRCm39) missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 115,950,000 (GRCm39) intron probably benign
IGL01695:Pik3c2a APN 7 116,016,753 (GRCm39) missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 115,945,423 (GRCm39) missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 115,950,039 (GRCm39) missense probably benign 0.00
IGL02160:Pik3c2a APN 7 115,987,299 (GRCm39) missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 115,962,575 (GRCm39) splice site probably benign
IGL02345:Pik3c2a APN 7 116,005,126 (GRCm39) missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 115,972,049 (GRCm39) missense probably benign 0.00
IGL02756:Pik3c2a APN 7 115,963,748 (GRCm39) missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116,017,256 (GRCm39) missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116,017,074 (GRCm39) missense probably benign 0.21
R0046:Pik3c2a UTSW 7 115,953,307 (GRCm39) missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 115,972,979 (GRCm39) missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 115,953,290 (GRCm39) missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 115,945,482 (GRCm39) splice site probably benign
R0991:Pik3c2a UTSW 7 115,961,280 (GRCm39) critical splice donor site probably null
R1074:Pik3c2a UTSW 7 115,950,160 (GRCm39) nonsense probably null
R1485:Pik3c2a UTSW 7 116,016,908 (GRCm39) missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 115,987,300 (GRCm39) missense probably benign 0.01
R1510:Pik3c2a UTSW 7 115,987,280 (GRCm39) missense probably benign 0.00
R1654:Pik3c2a UTSW 7 115,968,083 (GRCm39) missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116,017,162 (GRCm39) nonsense probably null
R1733:Pik3c2a UTSW 7 116,017,755 (GRCm39) start codon destroyed possibly damaging 0.96
R1751:Pik3c2a UTSW 7 115,945,471 (GRCm39) missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116,016,899 (GRCm39) missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 115,975,747 (GRCm39) critical splice donor site probably null
R1826:Pik3c2a UTSW 7 115,967,352 (GRCm39) missense probably benign
R1875:Pik3c2a UTSW 7 116,017,206 (GRCm39) missense probably benign 0.35
R1995:Pik3c2a UTSW 7 115,953,241 (GRCm39) missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 115,941,472 (GRCm39) missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 115,963,738 (GRCm39) missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 115,950,166 (GRCm39) critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 115,950,166 (GRCm39) critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 115,950,166 (GRCm39) critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 115,950,057 (GRCm39) missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116,016,686 (GRCm39) critical splice donor site probably null
R2068:Pik3c2a UTSW 7 115,972,126 (GRCm39) nonsense probably null
R3814:Pik3c2a UTSW 7 115,947,414 (GRCm39) missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 115,963,785 (GRCm39) nonsense probably null
R4386:Pik3c2a UTSW 7 115,953,334 (GRCm39) missense probably damaging 1.00
R4783:Pik3c2a UTSW 7 116,017,060 (GRCm39) missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 115,939,391 (GRCm39) missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 115,939,391 (GRCm39) missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 115,975,518 (GRCm39) missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 115,947,509 (GRCm39) missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 115,941,636 (GRCm39) missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 115,950,021 (GRCm39) missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116,016,893 (GRCm39) missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116,005,186 (GRCm39) missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 115,972,049 (GRCm39) missense probably benign 0.00
R5951:Pik3c2a UTSW 7 115,967,419 (GRCm39) missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 115,961,799 (GRCm39) missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 115,947,440 (GRCm39) missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116,016,731 (GRCm39) missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 115,939,460 (GRCm39) critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 115,967,993 (GRCm39) missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 115,961,419 (GRCm39) missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 115,993,540 (GRCm39) missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116,017,223 (GRCm39) missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116,017,368 (GRCm39) nonsense probably null
R7153:Pik3c2a UTSW 7 115,941,487 (GRCm39) missense probably damaging 1.00
R7176:Pik3c2a UTSW 7 115,987,331 (GRCm39) missense possibly damaging 0.47
R7265:Pik3c2a UTSW 7 115,987,321 (GRCm39) missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116,005,178 (GRCm39) missense probably benign 0.00
R7308:Pik3c2a UTSW 7 115,973,074 (GRCm39) missense probably damaging 1.00
R7375:Pik3c2a UTSW 7 115,975,621 (GRCm39) missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 115,953,242 (GRCm39) missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 115,972,089 (GRCm39) missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 115,993,474 (GRCm39) missense probably damaging 1.00
R7539:Pik3c2a UTSW 7 115,939,331 (GRCm39) missense probably damaging 0.97
R7684:Pik3c2a UTSW 7 115,987,312 (GRCm39) nonsense probably null
R7737:Pik3c2a UTSW 7 115,955,488 (GRCm39) missense probably damaging 0.99
R7739:Pik3c2a UTSW 7 115,993,529 (GRCm39) missense probably benign 0.26
R7852:Pik3c2a UTSW 7 116,016,693 (GRCm39) missense probably benign
R7922:Pik3c2a UTSW 7 115,990,517 (GRCm39) missense probably damaging 1.00
R7956:Pik3c2a UTSW 7 115,949,350 (GRCm39) missense probably benign 0.01
R8005:Pik3c2a UTSW 7 116,017,271 (GRCm39) missense probably damaging 1.00
R8158:Pik3c2a UTSW 7 115,942,232 (GRCm39) missense probably benign 0.00
R8329:Pik3c2a UTSW 7 116,017,283 (GRCm39) missense probably damaging 1.00
R8478:Pik3c2a UTSW 7 116,017,584 (GRCm39) missense probably damaging 0.96
R8736:Pik3c2a UTSW 7 115,975,464 (GRCm39) missense possibly damaging 0.47
R8812:Pik3c2a UTSW 7 115,951,112 (GRCm39) missense probably damaging 1.00
R8922:Pik3c2a UTSW 7 116,017,659 (GRCm39) missense probably damaging 1.00
R8953:Pik3c2a UTSW 7 115,987,320 (GRCm39) missense probably benign 0.19
R9105:Pik3c2a UTSW 7 115,972,049 (GRCm39) missense probably benign 0.00
R9111:Pik3c2a UTSW 7 115,993,531 (GRCm39) missense probably damaging 0.99
R9152:Pik3c2a UTSW 7 116,017,004 (GRCm39) missense probably benign 0.30
R9241:Pik3c2a UTSW 7 116,017,115 (GRCm39) missense probably benign 0.02
R9301:Pik3c2a UTSW 7 115,945,413 (GRCm39) missense probably damaging 1.00
R9325:Pik3c2a UTSW 7 115,990,558 (GRCm39) missense probably damaging 0.99
R9482:Pik3c2a UTSW 7 115,961,289 (GRCm39) missense probably benign 0.04
R9513:Pik3c2a UTSW 7 115,939,321 (GRCm39) missense probably benign 0.06
R9569:Pik3c2a UTSW 7 115,957,939 (GRCm39) missense possibly damaging 0.89
R9758:Pik3c2a UTSW 7 115,945,427 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTAAGTCTAGGCCTTCAG -3'
(R):5'- GGATCATGTAAATGCTAGTTAACAGCC -3'

Sequencing Primer
(F):5'- TCCAGTCTGGTCTACATAGCAAG -3'
(R):5'- ACAGCCATTGTTTGATTTGCTG -3'
Posted On 2015-10-08