Incidental Mutation 'R4668:Myh10'
ID352182
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4668 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68804642 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1532 (K1532E)
Ref Sequence ENSEMBL: ENSMUSP00000099671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
Predicted Effect probably damaging
Transcript: ENSMUST00000018887
AA Change: K1563E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900
AA Change: K1563E

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092984
AA Change: K1569E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900
AA Change: K1569E

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102611
AA Change: K1532E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900
AA Change: K1532E

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A T 9: 114,304,711 noncoding transcript Het
6430548M08Rik T C 8: 120,160,414 probably null Het
Abca4 G A 3: 122,155,299 G531E possibly damaging Het
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Acot10 T C 15: 20,665,942 S238G probably benign Het
Adamtsl2 A T 2: 27,095,475 H457L probably benign Het
Ankrd35 A T 3: 96,679,208 T67S probably damaging Het
Aox2 T G 1: 58,334,694 I838S possibly damaging Het
Arnt2 T C 7: 84,275,386 N411S probably damaging Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Carns1 A T 19: 4,165,476 Y902* probably null Het
Cavin1 T C 11: 100,958,796 E336G probably damaging Het
Cbl A T 9: 44,153,848 C728S probably benign Het
Ccdc136 C A 6: 29,411,281 Q218K probably damaging Het
Cdk19 C A 10: 40,466,710 T196K probably damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Ces3a A C 8: 105,053,423 K299T probably damaging Het
Cfap61 A T 2: 146,143,136 I967F probably damaging Het
Cnksr1 C T 4: 134,232,971 probably benign Het
Cped1 T C 6: 22,237,653 Y923H probably benign Het
Crip3 T C 17: 46,429,364 L30P probably damaging Het
Csmd1 A G 8: 16,023,891 I2030T possibly damaging Het
Ctse C A 1: 131,662,749 P70T probably damaging Het
Cyp2b23 A G 7: 26,672,734 F429L probably damaging Het
Cyp2c66 T A 19: 39,176,656 D360E probably damaging Het
D8Ertd738e A T 8: 84,249,481 L46* probably null Het
Dcp2 T A 18: 44,415,362 probably null Het
Ddx10 C A 9: 53,099,213 D834Y possibly damaging Het
Ddx19a A T 8: 110,979,084 V245E probably damaging Het
Dpf2 A C 19: 5,904,487 D130E probably benign Het
Emc8 A T 8: 120,667,779 M67K probably damaging Het
Ephb6 T C 6: 41,614,602 L231P possibly damaging Het
Erp27 T C 6: 136,908,152 E216G possibly damaging Het
Esco1 A T 18: 10,594,734 I184N possibly damaging Het
Fam205c A G 4: 42,871,608 F256L probably benign Het
Fdxacb1 T A 9: 50,770,260 D11E possibly damaging Het
Fhod3 C T 18: 25,066,338 P689S probably benign Het
Fnip1 T A 11: 54,503,559 S940R probably damaging Het
Ganc G T 2: 120,431,067 V343F probably benign Het
Gldn T A 9: 54,332,018 L228* probably null Het
Gm1123 C T 9: 99,009,373 R341H probably damaging Het
Gtf2f2 T C 14: 75,917,638 Y161C probably benign Het
Gtf3c1 T C 7: 125,667,338 T979A probably damaging Het
Hist1h4a A G 13: 23,760,976 V61A probably benign Het
Hmcn2 G T 2: 31,435,792 R4277L probably benign Het
Hsd17b6 T A 10: 127,994,426 probably null Het
Igkv12-46 T C 6: 69,764,797 T25A probably damaging Het
Inpp5e G A 2: 26,400,994 R354C probably damaging Het
Jcad T A 18: 4,680,221 probably null Het
Kcna10 G T 3: 107,194,694 A214S possibly damaging Het
Kit T C 5: 75,641,220 probably null Het
Kmt2a G A 9: 44,824,572 probably benign Het
Lama1 T C 17: 67,752,434 V604A probably benign Het
Mesd T C 7: 83,895,756 V138A probably damaging Het
Mmp13 T C 9: 7,272,580 F9S possibly damaging Het
Mocos T C 18: 24,666,434 Y242H probably benign Het
Mrc1 A C 2: 14,293,486 T718P probably damaging Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Nat9 T C 11: 115,184,542 N91S probably damaging Het
Neto2 A T 8: 85,641,062 I351N probably damaging Het
Nfx1 A G 4: 40,976,367 N14D possibly damaging Het
Nlrp4b A G 7: 10,714,733 T288A possibly damaging Het
Nutm2 C A 13: 50,472,997 T396K probably benign Het
Ogdhl A G 14: 32,332,536 T196A probably benign Het
Olfr1453 A T 19: 13,028,081 F83I probably benign Het
Olfr548-ps1 A G 7: 102,542,604 I223V possibly damaging Het
Olfr582 A T 7: 103,041,851 D119V probably benign Het
Omg T A 11: 79,502,423 N203I probably damaging Het
Pdgfrb A G 18: 61,064,113 Y207C probably damaging Het
Pdzd7 T A 19: 45,045,687 probably benign Het
Pgs1 C A 11: 118,003,507 H157N probably damaging Het
Pik3c2a A G 7: 116,358,688 V1121A probably benign Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Pms1 G A 1: 53,189,474 Q872* probably null Het
Ptgs2 A G 1: 150,101,084 T23A probably benign Het
Rgl1 T G 1: 152,521,371 R716S probably damaging Het
Rif1 A G 2: 52,111,952 E1806G probably benign Het
Ripor1 T C 8: 105,614,652 V39A probably benign Het
Ryr2 G T 13: 11,593,117 T868N probably benign Het
Sec22b A T 3: 97,921,122 D167V probably damaging Het
Sec24d T C 3: 123,355,774 V810A probably damaging Het
Shh T C 5: 28,457,855 *438W probably null Het
Slc25a12 G A 2: 71,315,062 S178L probably benign Het
Sorl1 A T 9: 41,984,508 W1784R probably damaging Het
Sp3 A T 2: 72,970,981 S229R probably damaging Het
Spdye4c G A 2: 128,592,353 V5I possibly damaging Het
Spint2 A T 7: 29,260,379 V53D probably damaging Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Stk25 A G 1: 93,625,483 S299P probably damaging Het
Sult2a3 A G 7: 14,122,861 S45P probably damaging Het
Thsd7a A T 6: 12,408,968 V685E probably damaging Het
Tm9sf4 T A 2: 153,187,308 V92D probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Topors G A 4: 40,262,669 T205I probably damaging Het
Tpo T A 12: 30,103,290 Y355F probably benign Het
Uba1y T A Y: 826,032 M396K possibly damaging Het
Vmn1r50 A T 6: 90,107,531 Q86L probably benign Het
Vmn1r77 A G 7: 12,041,431 K45E probably damaging Het
Vmn2r114 A C 17: 23,310,473 N218K possibly damaging Het
Vmn2r66 T A 7: 84,994,697 N835I probably damaging Het
Vps54 T G 11: 21,299,989 N458K probably benign Het
Zcchc7 G T 4: 44,895,964 C304F probably damaging Het
Zfp335 A T 2: 164,900,286 C593S probably damaging Het
Zmynd15 C G 11: 70,462,588 P214R probably damaging Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68765092 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1754:Myh10 UTSW 11 68813058 missense probably damaging 0.98
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2136:Myh10 UTSW 11 68804714 missense probably damaging 1.00
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R2351:Myh10 UTSW 11 68793139 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5288:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68785859 missense probably damaging 1.00
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7329:Myh10 UTSW 11 68810191 missense probably benign 0.44
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7681:Myh10 UTSW 11 68771936 missense probably damaging 0.98
R7813:Myh10 UTSW 11 68785909 missense probably benign 0.00
R7834:Myh10 UTSW 11 68785826 missense probably damaging 1.00
R7922:Myh10 UTSW 11 68808893 missense possibly damaging 0.56
R7938:Myh10 UTSW 11 68692501 missense unknown
R7958:Myh10 UTSW 11 68721347 missense probably benign 0.00
R7994:Myh10 UTSW 11 68790244 critical splice donor site probably null
R8395:Myh10 UTSW 11 68792016 missense probably damaging 0.98
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTCTTCTGAGGCTCACAC -3'
(R):5'- ACTGCCAGACTCAGCCTTTC -3'

Sequencing Primer
(F):5'- CTCACACAGCAGGCGCC -3'
(R):5'- TAGTGCTTCCCAGGGCAC -3'
Posted On2015-10-08