Incidental Mutation 'R4668:Zmynd15'
ID 352183
Institutional Source Beutler Lab
Gene Symbol Zmynd15
Ensembl Gene ENSMUSG00000040829
Gene Name zinc finger, MYND-type containing 15
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.158) question?
Stock # R4668 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70350259-70357028 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 70353414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 214 (P214R)
Ref Sequence ENSEMBL: ENSMUSP00000104203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019064] [ENSMUST00000039093] [ENSMUST00000092958] [ENSMUST00000108563] [ENSMUST00000126105] [ENSMUST00000126391] [ENSMUST00000147289]
AlphaFold Q8C0R7
Predicted Effect probably benign
Transcript: ENSMUST00000019064
SMART Domains Protein: ENSMUSP00000019064
Gene: ENSMUSG00000018920

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:SCY 32 94 1e-17 BLAST
transmembrane domain 201 223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039093
AA Change: P344R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048816
Gene: ENSMUSG00000040829
AA Change: P344R

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 307 353 6.7e-12 PFAM
low complexity region 438 452 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 702 736 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092958
AA Change: P343R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090635
Gene: ENSMUSG00000040829
AA Change: P343R

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 306 352 6.5e-11 PFAM
low complexity region 437 451 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 662 696 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108563
AA Change: P214R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104203
Gene: ENSMUSG00000040829
AA Change: P214R

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
Pfam:zf-MYND 177 223 2.5e-11 PFAM
low complexity region 308 322 N/A INTRINSIC
low complexity region 393 405 N/A INTRINSIC
low complexity region 572 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126105
SMART Domains Protein: ENSMUSP00000134599
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126391
SMART Domains Protein: ENSMUSP00000133513
Gene: ENSMUSG00000018920

DomainStartEndE-ValueType
Blast:SCY 19 81 3e-18 BLAST
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136029
Predicted Effect probably benign
Transcript: ENSMUST00000147289
SMART Domains Protein: ENSMUSP00000136813
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154475
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a MYND-containing zinc-binding protein with a nuclear localization sequence. A similar gene in mice has been shown to act as a testis-specific transcriptional repressor by recruiting histone deacetylase enzymes to regulate spatiotemporal expression of many haploid genes. This protein may play an important role in spermatogenesis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele of Cxcl16 and Zmynd15 exhibit abnormal spermiogenesis and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A T 9: 114,133,779 (GRCm39) noncoding transcript Het
6430548M08Rik T C 8: 120,887,153 (GRCm39) probably null Het
Abca4 G A 3: 121,948,948 (GRCm39) G531E possibly damaging Het
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Acot10 T C 15: 20,666,028 (GRCm39) S238G probably benign Het
Adamtsl2 A T 2: 26,985,487 (GRCm39) H457L probably benign Het
Ankrd35 A T 3: 96,586,524 (GRCm39) T67S probably damaging Het
Aox1 T G 1: 58,373,853 (GRCm39) I838S possibly damaging Het
Arnt2 T C 7: 83,924,594 (GRCm39) N411S probably damaging Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Carns1 A T 19: 4,215,475 (GRCm39) Y902* probably null Het
Cavin1 T C 11: 100,849,622 (GRCm39) E336G probably damaging Het
Cbl A T 9: 44,065,145 (GRCm39) C728S probably benign Het
Ccdc136 C A 6: 29,411,280 (GRCm39) Q218K probably damaging Het
Cdk19 C A 10: 40,342,706 (GRCm39) T196K probably damaging Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Ces3a A C 8: 105,780,055 (GRCm39) K299T probably damaging Het
Cfap61 A T 2: 145,985,056 (GRCm39) I967F probably damaging Het
Cnksr1 C T 4: 133,960,282 (GRCm39) probably benign Het
Cped1 T C 6: 22,237,652 (GRCm39) Y923H probably benign Het
Crip3 T C 17: 46,740,290 (GRCm39) L30P probably damaging Het
Csmd1 A G 8: 16,073,905 (GRCm39) I2030T possibly damaging Het
Ctse C A 1: 131,590,487 (GRCm39) P70T probably damaging Het
Cyp2b23 A G 7: 26,372,159 (GRCm39) F429L probably damaging Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
D8Ertd738e A T 8: 84,976,110 (GRCm39) L46* probably null Het
Dcp2 T A 18: 44,548,429 (GRCm39) probably null Het
Ddx10 C A 9: 53,010,513 (GRCm39) D834Y possibly damaging Het
Ddx19a A T 8: 111,705,716 (GRCm39) V245E probably damaging Het
Dpf2 A C 19: 5,954,515 (GRCm39) D130E probably benign Het
Emc8 A T 8: 121,394,518 (GRCm39) M67K probably damaging Het
Ephb6 T C 6: 41,591,536 (GRCm39) L231P possibly damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
Esco1 A T 18: 10,594,734 (GRCm39) I184N possibly damaging Het
Fdxacb1 T A 9: 50,681,560 (GRCm39) D11E possibly damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnip1 T A 11: 54,394,385 (GRCm39) S940R probably damaging Het
Ganc G T 2: 120,261,548 (GRCm39) V343F probably benign Het
Gldn T A 9: 54,239,302 (GRCm39) L228* probably null Het
Gm1123 C T 9: 98,891,426 (GRCm39) R341H probably damaging Het
Gtf2f2 T C 14: 76,155,078 (GRCm39) Y161C probably benign Het
Gtf3c1 T C 7: 125,266,510 (GRCm39) T979A probably damaging Het
H4c1 A G 13: 23,944,959 (GRCm39) V61A probably benign Het
Hmcn2 G T 2: 31,325,804 (GRCm39) R4277L probably benign Het
Hsd17b6 T A 10: 127,830,295 (GRCm39) probably null Het
Igkv12-46 T C 6: 69,741,781 (GRCm39) T25A probably damaging Het
Inpp5e G A 2: 26,291,006 (GRCm39) R354C probably damaging Het
Jcad T A 18: 4,680,221 (GRCm39) probably null Het
Kcna10 G T 3: 107,102,010 (GRCm39) A214S possibly damaging Het
Kit T C 5: 75,801,880 (GRCm39) probably null Het
Kmt2a G A 9: 44,735,869 (GRCm39) probably benign Het
Lama1 T C 17: 68,059,429 (GRCm39) V604A probably benign Het
Mesd T C 7: 83,544,964 (GRCm39) V138A probably damaging Het
Mmp13 T C 9: 7,272,580 (GRCm39) F9S possibly damaging Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Mrc1 A C 2: 14,298,297 (GRCm39) T718P probably damaging Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Myh10 A G 11: 68,695,468 (GRCm39) K1532E probably damaging Het
Nat9 T C 11: 115,075,368 (GRCm39) N91S probably damaging Het
Neto2 A T 8: 86,367,691 (GRCm39) I351N probably damaging Het
Nfx1 A G 4: 40,976,367 (GRCm39) N14D possibly damaging Het
Nlrp4b A G 7: 10,448,660 (GRCm39) T288A possibly damaging Het
Nutm2 C A 13: 50,627,033 (GRCm39) T396K probably benign Het
Ogdhl A G 14: 32,054,493 (GRCm39) T196A probably benign Het
Omg T A 11: 79,393,249 (GRCm39) N203I probably damaging Het
Or52b4i A G 7: 102,191,811 (GRCm39) I223V possibly damaging Het
Or52r1b A T 7: 102,691,058 (GRCm39) D119V probably benign Het
Or5b101 A T 19: 13,005,445 (GRCm39) F83I probably benign Het
Pdgfrb A G 18: 61,197,185 (GRCm39) Y207C probably damaging Het
Pdzd7 T A 19: 45,034,126 (GRCm39) probably benign Het
Pgs1 C A 11: 117,894,333 (GRCm39) H157N probably damaging Het
Pik3c2a A G 7: 115,957,923 (GRCm39) V1121A probably benign Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Pms1 G A 1: 53,228,633 (GRCm39) Q872* probably null Het
Ptgs2 A G 1: 149,976,835 (GRCm39) T23A probably benign Het
Rgl1 T G 1: 152,397,122 (GRCm39) R716S probably damaging Het
Rif1 A G 2: 52,001,964 (GRCm39) E1806G probably benign Het
Ripor1 T C 8: 106,341,284 (GRCm39) V39A probably benign Het
Ryr2 G T 13: 11,608,003 (GRCm39) T868N probably benign Het
Sec22b A T 3: 97,828,438 (GRCm39) D167V probably damaging Het
Sec24d T C 3: 123,149,423 (GRCm39) V810A probably damaging Het
Shh T C 5: 28,662,853 (GRCm39) *438W probably null Het
Slc25a12 G A 2: 71,145,406 (GRCm39) S178L probably benign Het
Sorl1 A T 9: 41,895,804 (GRCm39) W1784R probably damaging Het
Sp3 A T 2: 72,801,325 (GRCm39) S229R probably damaging Het
Spata31f3 A G 4: 42,871,608 (GRCm39) F256L probably benign Het
Spdye4c G A 2: 128,434,273 (GRCm39) V5I possibly damaging Het
Spint2 A T 7: 28,959,804 (GRCm39) V53D probably damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Stk25 A G 1: 93,553,205 (GRCm39) S299P probably damaging Het
Sult2a3 A G 7: 13,856,786 (GRCm39) S45P probably damaging Het
Thsd7a A T 6: 12,408,967 (GRCm39) V685E probably damaging Het
Tm9sf4 T A 2: 153,029,228 (GRCm39) V92D probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Topors G A 4: 40,262,669 (GRCm39) T205I probably damaging Het
Tpo T A 12: 30,153,289 (GRCm39) Y355F probably benign Het
Uba1y T A Y: 826,032 (GRCm39) M396K possibly damaging Het
Vmn1r50 A T 6: 90,084,513 (GRCm39) Q86L probably benign Het
Vmn1r77 A G 7: 11,775,358 (GRCm39) K45E probably damaging Het
Vmn2r114 A C 17: 23,529,447 (GRCm39) N218K possibly damaging Het
Vmn2r66 T A 7: 84,643,905 (GRCm39) N835I probably damaging Het
Vps54 T G 11: 21,249,989 (GRCm39) N458K probably benign Het
Zcchc7 G T 4: 44,895,964 (GRCm39) C304F probably damaging Het
Zfp335 A T 2: 164,742,206 (GRCm39) C593S probably damaging Het
Other mutations in Zmynd15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Zmynd15 APN 11 70,356,742 (GRCm39) missense probably damaging 1.00
IGL01351:Zmynd15 APN 11 70,354,416 (GRCm39) missense probably benign 0.28
R0086:Zmynd15 UTSW 11 70,355,058 (GRCm39) missense probably damaging 1.00
R0196:Zmynd15 UTSW 11 70,355,052 (GRCm39) missense probably damaging 1.00
R0667:Zmynd15 UTSW 11 70,355,944 (GRCm39) missense probably damaging 1.00
R1511:Zmynd15 UTSW 11 70,355,619 (GRCm39) missense probably damaging 0.98
R1660:Zmynd15 UTSW 11 70,354,328 (GRCm39) missense probably damaging 1.00
R1750:Zmynd15 UTSW 11 70,353,393 (GRCm39) missense probably benign 0.00
R4344:Zmynd15 UTSW 11 70,351,894 (GRCm39) nonsense probably null
R4594:Zmynd15 UTSW 11 70,355,008 (GRCm39) missense probably damaging 1.00
R5029:Zmynd15 UTSW 11 70,353,387 (GRCm39) missense probably damaging 1.00
R5075:Zmynd15 UTSW 11 70,352,946 (GRCm39) missense probably damaging 1.00
R5289:Zmynd15 UTSW 11 70,356,830 (GRCm39) missense unknown
R5468:Zmynd15 UTSW 11 70,352,646 (GRCm39) missense probably damaging 1.00
R6350:Zmynd15 UTSW 11 70,355,257 (GRCm39) missense probably damaging 1.00
R6665:Zmynd15 UTSW 11 70,355,636 (GRCm39) missense probably benign 0.01
R7078:Zmynd15 UTSW 11 70,351,581 (GRCm39) missense probably damaging 1.00
R7426:Zmynd15 UTSW 11 70,353,014 (GRCm39) missense probably benign 0.06
R7475:Zmynd15 UTSW 11 70,351,867 (GRCm39) missense probably benign
R7673:Zmynd15 UTSW 11 70,356,866 (GRCm39) missense unknown
R8003:Zmynd15 UTSW 11 70,351,767 (GRCm39) missense probably benign 0.00
R8079:Zmynd15 UTSW 11 70,350,278 (GRCm39) unclassified probably benign
R8536:Zmynd15 UTSW 11 70,353,387 (GRCm39) missense probably damaging 1.00
R8828:Zmynd15 UTSW 11 70,355,017 (GRCm39) missense probably damaging 1.00
R8972:Zmynd15 UTSW 11 70,355,065 (GRCm39) missense possibly damaging 0.73
Z1088:Zmynd15 UTSW 11 70,351,961 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GACTTGAGCAGTTGGCCAAAC -3'
(R):5'- TTCAAGCCCTGGATCCTGTATC -3'

Sequencing Primer
(F):5'- GGCTGTTAGTTAAAGGCTGCAATAC -3'
(R):5'- TGGATCCTGTATCAAAGACCCGG -3'
Posted On 2015-10-08