Incidental Mutation 'R4668:Stard3nl'
ID 352190
Institutional Source Beutler Lab
Gene Symbol Stard3nl
Ensembl Gene ENSMUSG00000003062
Gene Name STARD3 N-terminal like
Synonyms 0610035N01Rik, 6530409L22Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R4668 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 19541846-19579965 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19560689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 29 (N29Y)
Ref Sequence ENSEMBL: ENSMUSP00000152373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039694] [ENSMUST00000197565] [ENSMUST00000199924] [ENSMUST00000200323] [ENSMUST00000222869] [ENSMUST00000221380]
AlphaFold Q9DCI3
Predicted Effect possibly damaging
Transcript: ENSMUST00000039694
AA Change: N29Y

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037991
Gene: ENSMUSG00000003062
AA Change: N29Y

DomainStartEndE-ValueType
Pfam:MENTAL 49 214 2.6e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196712
Predicted Effect possibly damaging
Transcript: ENSMUST00000197565
AA Change: N29Y

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199278
Predicted Effect probably benign
Transcript: ENSMUST00000199924
Predicted Effect probably damaging
Transcript: ENSMUST00000200323
AA Change: N29Y

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142680
Gene: ENSMUSG00000003062
AA Change: N29Y

DomainStartEndE-ValueType
Pfam:MENTAL 49 216 2e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000222869
AA Change: N29Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000221380
AA Change: N29Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a late-endosomal protein that contains a conserved MENTAL (MLN64 N-terminal) domain. The encoded protein binds cholesterol molecules and may play a role in endosomal cholesterol transport through interactions with metastatic lymph node protein 64 (MLN64). [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A T 9: 114,133,779 (GRCm39) noncoding transcript Het
6430548M08Rik T C 8: 120,887,153 (GRCm39) probably null Het
Abca4 G A 3: 121,948,948 (GRCm39) G531E possibly damaging Het
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Acot10 T C 15: 20,666,028 (GRCm39) S238G probably benign Het
Adamtsl2 A T 2: 26,985,487 (GRCm39) H457L probably benign Het
Ankrd35 A T 3: 96,586,524 (GRCm39) T67S probably damaging Het
Aox1 T G 1: 58,373,853 (GRCm39) I838S possibly damaging Het
Arnt2 T C 7: 83,924,594 (GRCm39) N411S probably damaging Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Carns1 A T 19: 4,215,475 (GRCm39) Y902* probably null Het
Cavin1 T C 11: 100,849,622 (GRCm39) E336G probably damaging Het
Cbl A T 9: 44,065,145 (GRCm39) C728S probably benign Het
Ccdc136 C A 6: 29,411,280 (GRCm39) Q218K probably damaging Het
Cdk19 C A 10: 40,342,706 (GRCm39) T196K probably damaging Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Ces3a A C 8: 105,780,055 (GRCm39) K299T probably damaging Het
Cfap61 A T 2: 145,985,056 (GRCm39) I967F probably damaging Het
Cnksr1 C T 4: 133,960,282 (GRCm39) probably benign Het
Cped1 T C 6: 22,237,652 (GRCm39) Y923H probably benign Het
Crip3 T C 17: 46,740,290 (GRCm39) L30P probably damaging Het
Csmd1 A G 8: 16,073,905 (GRCm39) I2030T possibly damaging Het
Ctse C A 1: 131,590,487 (GRCm39) P70T probably damaging Het
Cyp2b23 A G 7: 26,372,159 (GRCm39) F429L probably damaging Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
D8Ertd738e A T 8: 84,976,110 (GRCm39) L46* probably null Het
Dcp2 T A 18: 44,548,429 (GRCm39) probably null Het
Ddx10 C A 9: 53,010,513 (GRCm39) D834Y possibly damaging Het
Ddx19a A T 8: 111,705,716 (GRCm39) V245E probably damaging Het
Dpf2 A C 19: 5,954,515 (GRCm39) D130E probably benign Het
Emc8 A T 8: 121,394,518 (GRCm39) M67K probably damaging Het
Ephb6 T C 6: 41,591,536 (GRCm39) L231P possibly damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
Esco1 A T 18: 10,594,734 (GRCm39) I184N possibly damaging Het
Fdxacb1 T A 9: 50,681,560 (GRCm39) D11E possibly damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnip1 T A 11: 54,394,385 (GRCm39) S940R probably damaging Het
Ganc G T 2: 120,261,548 (GRCm39) V343F probably benign Het
Gldn T A 9: 54,239,302 (GRCm39) L228* probably null Het
Gm1123 C T 9: 98,891,426 (GRCm39) R341H probably damaging Het
Gtf2f2 T C 14: 76,155,078 (GRCm39) Y161C probably benign Het
Gtf3c1 T C 7: 125,266,510 (GRCm39) T979A probably damaging Het
H4c1 A G 13: 23,944,959 (GRCm39) V61A probably benign Het
Hmcn2 G T 2: 31,325,804 (GRCm39) R4277L probably benign Het
Hsd17b6 T A 10: 127,830,295 (GRCm39) probably null Het
Igkv12-46 T C 6: 69,741,781 (GRCm39) T25A probably damaging Het
Inpp5e G A 2: 26,291,006 (GRCm39) R354C probably damaging Het
Jcad T A 18: 4,680,221 (GRCm39) probably null Het
Kcna10 G T 3: 107,102,010 (GRCm39) A214S possibly damaging Het
Kit T C 5: 75,801,880 (GRCm39) probably null Het
Kmt2a G A 9: 44,735,869 (GRCm39) probably benign Het
Lama1 T C 17: 68,059,429 (GRCm39) V604A probably benign Het
Mesd T C 7: 83,544,964 (GRCm39) V138A probably damaging Het
Mmp13 T C 9: 7,272,580 (GRCm39) F9S possibly damaging Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Mrc1 A C 2: 14,298,297 (GRCm39) T718P probably damaging Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Myh10 A G 11: 68,695,468 (GRCm39) K1532E probably damaging Het
Nat9 T C 11: 115,075,368 (GRCm39) N91S probably damaging Het
Neto2 A T 8: 86,367,691 (GRCm39) I351N probably damaging Het
Nfx1 A G 4: 40,976,367 (GRCm39) N14D possibly damaging Het
Nlrp4b A G 7: 10,448,660 (GRCm39) T288A possibly damaging Het
Nutm2 C A 13: 50,627,033 (GRCm39) T396K probably benign Het
Ogdhl A G 14: 32,054,493 (GRCm39) T196A probably benign Het
Omg T A 11: 79,393,249 (GRCm39) N203I probably damaging Het
Or52b4i A G 7: 102,191,811 (GRCm39) I223V possibly damaging Het
Or52r1b A T 7: 102,691,058 (GRCm39) D119V probably benign Het
Or5b101 A T 19: 13,005,445 (GRCm39) F83I probably benign Het
Pdgfrb A G 18: 61,197,185 (GRCm39) Y207C probably damaging Het
Pdzd7 T A 19: 45,034,126 (GRCm39) probably benign Het
Pgs1 C A 11: 117,894,333 (GRCm39) H157N probably damaging Het
Pik3c2a A G 7: 115,957,923 (GRCm39) V1121A probably benign Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Pms1 G A 1: 53,228,633 (GRCm39) Q872* probably null Het
Ptgs2 A G 1: 149,976,835 (GRCm39) T23A probably benign Het
Rgl1 T G 1: 152,397,122 (GRCm39) R716S probably damaging Het
Rif1 A G 2: 52,001,964 (GRCm39) E1806G probably benign Het
Ripor1 T C 8: 106,341,284 (GRCm39) V39A probably benign Het
Ryr2 G T 13: 11,608,003 (GRCm39) T868N probably benign Het
Sec22b A T 3: 97,828,438 (GRCm39) D167V probably damaging Het
Sec24d T C 3: 123,149,423 (GRCm39) V810A probably damaging Het
Shh T C 5: 28,662,853 (GRCm39) *438W probably null Het
Slc25a12 G A 2: 71,145,406 (GRCm39) S178L probably benign Het
Sorl1 A T 9: 41,895,804 (GRCm39) W1784R probably damaging Het
Sp3 A T 2: 72,801,325 (GRCm39) S229R probably damaging Het
Spata31f3 A G 4: 42,871,608 (GRCm39) F256L probably benign Het
Spdye4c G A 2: 128,434,273 (GRCm39) V5I possibly damaging Het
Spint2 A T 7: 28,959,804 (GRCm39) V53D probably damaging Het
Stk25 A G 1: 93,553,205 (GRCm39) S299P probably damaging Het
Sult2a3 A G 7: 13,856,786 (GRCm39) S45P probably damaging Het
Thsd7a A T 6: 12,408,967 (GRCm39) V685E probably damaging Het
Tm9sf4 T A 2: 153,029,228 (GRCm39) V92D probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Topors G A 4: 40,262,669 (GRCm39) T205I probably damaging Het
Tpo T A 12: 30,153,289 (GRCm39) Y355F probably benign Het
Uba1y T A Y: 826,032 (GRCm39) M396K possibly damaging Het
Vmn1r50 A T 6: 90,084,513 (GRCm39) Q86L probably benign Het
Vmn1r77 A G 7: 11,775,358 (GRCm39) K45E probably damaging Het
Vmn2r114 A C 17: 23,529,447 (GRCm39) N218K possibly damaging Het
Vmn2r66 T A 7: 84,643,905 (GRCm39) N835I probably damaging Het
Vps54 T G 11: 21,249,989 (GRCm39) N458K probably benign Het
Zcchc7 G T 4: 44,895,964 (GRCm39) C304F probably damaging Het
Zfp335 A T 2: 164,742,206 (GRCm39) C593S probably damaging Het
Zmynd15 C G 11: 70,353,414 (GRCm39) P214R probably damaging Het
Other mutations in Stard3nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01907:Stard3nl APN 13 19,556,759 (GRCm39) missense probably damaging 1.00
IGL03080:Stard3nl APN 13 19,554,648 (GRCm39) critical splice donor site probably null
R0838:Stard3nl UTSW 13 19,556,756 (GRCm39) critical splice donor site probably null
R1436:Stard3nl UTSW 13 19,556,819 (GRCm39) missense probably damaging 1.00
R1625:Stard3nl UTSW 13 19,556,754 (GRCm39) splice site probably null
R4360:Stard3nl UTSW 13 19,554,654 (GRCm39) missense probably damaging 1.00
R4599:Stard3nl UTSW 13 19,551,923 (GRCm39) missense probably damaging 1.00
R4609:Stard3nl UTSW 13 19,554,434 (GRCm39) missense probably damaging 0.98
R4667:Stard3nl UTSW 13 19,560,689 (GRCm39) missense probably damaging 1.00
R4669:Stard3nl UTSW 13 19,560,689 (GRCm39) missense probably damaging 1.00
R4740:Stard3nl UTSW 13 19,560,736 (GRCm39) missense probably damaging 0.99
R4740:Stard3nl UTSW 13 19,551,948 (GRCm39) missense probably benign 0.34
R7633:Stard3nl UTSW 13 19,552,008 (GRCm39) missense probably damaging 1.00
R7673:Stard3nl UTSW 13 19,551,923 (GRCm39) missense probably benign 0.32
R8080:Stard3nl UTSW 13 19,554,521 (GRCm39) missense probably damaging 0.99
R8268:Stard3nl UTSW 13 19,560,629 (GRCm39) missense probably damaging 1.00
R9163:Stard3nl UTSW 13 19,560,809 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTAGCAAGTCATGAGCAAAACC -3'
(R):5'- ACATGTCTATGTCACAGCACTGTG -3'

Sequencing Primer
(F):5'- TGAGCAAAACCAACTTACATTTAAC -3'
(R):5'- CCATCAGCATAGGTGTAACGTG -3'
Posted On 2015-10-08