Incidental Mutation 'R4668:Top2b'
ID352193
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4668 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 16409189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 777 (I777M)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: I777M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I777M

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159302
SMART Domains Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 1 177 4.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160501
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Meta Mutation Damage Score 0.426 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A T 9: 114,304,711 noncoding transcript Het
6430548M08Rik T C 8: 120,160,414 probably null Het
Abca4 G A 3: 122,155,299 G531E possibly damaging Het
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Acot10 T C 15: 20,665,942 S238G probably benign Het
Adamtsl2 A T 2: 27,095,475 H457L probably benign Het
Ankrd35 A T 3: 96,679,208 T67S probably damaging Het
Aox2 T G 1: 58,334,694 I838S possibly damaging Het
Arnt2 T C 7: 84,275,386 N411S probably damaging Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Carns1 A T 19: 4,165,476 Y902* probably null Het
Cavin1 T C 11: 100,958,796 E336G probably damaging Het
Cbl A T 9: 44,153,848 C728S probably benign Het
Ccdc136 C A 6: 29,411,281 Q218K probably damaging Het
Cdk19 C A 10: 40,466,710 T196K probably damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Ces3a A C 8: 105,053,423 K299T probably damaging Het
Cfap61 A T 2: 146,143,136 I967F probably damaging Het
Cnksr1 C T 4: 134,232,971 probably benign Het
Cped1 T C 6: 22,237,653 Y923H probably benign Het
Crip3 T C 17: 46,429,364 L30P probably damaging Het
Csmd1 A G 8: 16,023,891 I2030T possibly damaging Het
Ctse C A 1: 131,662,749 P70T probably damaging Het
Cyp2b23 A G 7: 26,672,734 F429L probably damaging Het
Cyp2c66 T A 19: 39,176,656 D360E probably damaging Het
D8Ertd738e A T 8: 84,249,481 L46* probably null Het
Dcp2 T A 18: 44,415,362 probably null Het
Ddx10 C A 9: 53,099,213 D834Y possibly damaging Het
Ddx19a A T 8: 110,979,084 V245E probably damaging Het
Dpf2 A C 19: 5,904,487 D130E probably benign Het
Emc8 A T 8: 120,667,779 M67K probably damaging Het
Ephb6 T C 6: 41,614,602 L231P possibly damaging Het
Erp27 T C 6: 136,908,152 E216G possibly damaging Het
Esco1 A T 18: 10,594,734 I184N possibly damaging Het
Fam205c A G 4: 42,871,608 F256L probably benign Het
Fdxacb1 T A 9: 50,770,260 D11E possibly damaging Het
Fhod3 C T 18: 25,066,338 P689S probably benign Het
Fnip1 T A 11: 54,503,559 S940R probably damaging Het
Ganc G T 2: 120,431,067 V343F probably benign Het
Gldn T A 9: 54,332,018 L228* probably null Het
Gm1123 C T 9: 99,009,373 R341H probably damaging Het
Gtf2f2 T C 14: 75,917,638 Y161C probably benign Het
Gtf3c1 T C 7: 125,667,338 T979A probably damaging Het
Hist1h4a A G 13: 23,760,976 V61A probably benign Het
Hmcn2 G T 2: 31,435,792 R4277L probably benign Het
Hsd17b6 T A 10: 127,994,426 probably null Het
Igkv12-46 T C 6: 69,764,797 T25A probably damaging Het
Inpp5e G A 2: 26,400,994 R354C probably damaging Het
Jcad T A 18: 4,680,221 probably null Het
Kcna10 G T 3: 107,194,694 A214S possibly damaging Het
Kit T C 5: 75,641,220 probably null Het
Kmt2a G A 9: 44,824,572 probably benign Het
Lama1 T C 17: 67,752,434 V604A probably benign Het
Mesd T C 7: 83,895,756 V138A probably damaging Het
Mmp13 T C 9: 7,272,580 F9S possibly damaging Het
Mocos T C 18: 24,666,434 Y242H probably benign Het
Mrc1 A C 2: 14,293,486 T718P probably damaging Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Myh10 A G 11: 68,804,642 K1532E probably damaging Het
Nat9 T C 11: 115,184,542 N91S probably damaging Het
Neto2 A T 8: 85,641,062 I351N probably damaging Het
Nfx1 A G 4: 40,976,367 N14D possibly damaging Het
Nlrp4b A G 7: 10,714,733 T288A possibly damaging Het
Nutm2 C A 13: 50,472,997 T396K probably benign Het
Ogdhl A G 14: 32,332,536 T196A probably benign Het
Olfr1453 A T 19: 13,028,081 F83I probably benign Het
Olfr548-ps1 A G 7: 102,542,604 I223V possibly damaging Het
Olfr582 A T 7: 103,041,851 D119V probably benign Het
Omg T A 11: 79,502,423 N203I probably damaging Het
Pdgfrb A G 18: 61,064,113 Y207C probably damaging Het
Pdzd7 T A 19: 45,045,687 probably benign Het
Pgs1 C A 11: 118,003,507 H157N probably damaging Het
Pik3c2a A G 7: 116,358,688 V1121A probably benign Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Pms1 G A 1: 53,189,474 Q872* probably null Het
Ptgs2 A G 1: 150,101,084 T23A probably benign Het
Rgl1 T G 1: 152,521,371 R716S probably damaging Het
Rif1 A G 2: 52,111,952 E1806G probably benign Het
Ripor1 T C 8: 105,614,652 V39A probably benign Het
Ryr2 G T 13: 11,593,117 T868N probably benign Het
Sec22b A T 3: 97,921,122 D167V probably damaging Het
Sec24d T C 3: 123,355,774 V810A probably damaging Het
Shh T C 5: 28,457,855 *438W probably null Het
Slc25a12 G A 2: 71,315,062 S178L probably benign Het
Sorl1 A T 9: 41,984,508 W1784R probably damaging Het
Sp3 A T 2: 72,970,981 S229R probably damaging Het
Spdye4c G A 2: 128,592,353 V5I possibly damaging Het
Spint2 A T 7: 29,260,379 V53D probably damaging Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Stk25 A G 1: 93,625,483 S299P probably damaging Het
Sult2a3 A G 7: 14,122,861 S45P probably damaging Het
Thsd7a A T 6: 12,408,968 V685E probably damaging Het
Tm9sf4 T A 2: 153,187,308 V92D probably damaging Het
Topors G A 4: 40,262,669 T205I probably damaging Het
Tpo T A 12: 30,103,290 Y355F probably benign Het
Uba1y T A Y: 826,032 M396K possibly damaging Het
Vmn1r50 A T 6: 90,107,531 Q86L probably benign Het
Vmn1r77 A G 7: 12,041,431 K45E probably damaging Het
Vmn2r114 A C 17: 23,310,473 N218K possibly damaging Het
Vmn2r66 T A 7: 84,994,697 N835I probably damaging Het
Vps54 T G 11: 21,299,989 N458K probably benign Het
Zcchc7 G T 4: 44,895,964 C304F probably damaging Het
Zfp335 A T 2: 164,900,286 C593S probably damaging Het
Zmynd15 C G 11: 70,462,588 P214R probably damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
X0028:Top2b UTSW 14 16384499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACTGAAGATGGGATCAACTG -3'
(R):5'- ATTTGAAGTACTCTCCCTGAGC -3'

Sequencing Primer
(F):5'- CTGAAGATGGGATCAACTGAGAACTG -3'
(R):5'- TCTCCCTGAGCAGAAAAACTAAATG -3'
Posted On2015-10-08