Mutagenetix > Incidental Mutation

Incidental Mutation 'R4668:Lama1'

352201

Institutional Source

Beutler Lab

Gene Symbol

Lama1

Ensembl Gene

ENSMUSG00000032796

Gene Name

laminin, alpha 1

Synonyms

Lama

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4668 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67697265-67822645 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67752434 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 604 (V604A)

Ref Sequence

ENSEMBL: ENSMUSP00000043957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035471]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035471
AA Change: V604A

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: V604A

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
LamNT	23	275	1.2e-131	SMART
EGF_Lam	277	331	1e-5	SMART
EGF_Lam	334	401	6.6e-6	SMART
EGF_Lam	404	458	9.11e-9	SMART
EGF_Lam	461	507	8.12e-6	SMART
LamB	570	702	2.09e-57	SMART
EGF_like	715	746	3.36e0	SMART
EGF_Lam	749	795	7.01e-10	SMART
EGF_Lam	798	853	3.59e-7	SMART
EGF_Lam	856	906	1.53e-10	SMART
EGF_Lam	909	955	1.13e-13	SMART
EGF_Lam	958	1002	1.36e-7	SMART
EGF_Lam	1005	1048	7.29e-8	SMART
EGF_like	1034	1082	4.83e1	SMART
EGF_Lam	1051	1094	1.67e-7	SMART
EGF_Lam	1097	1154	1.32e-5	SMART
LamB	1220	1352	8.7e-46	SMART
Pfam:Laminin_EGF	1367	1397	1.7e-6	PFAM
EGF_Lam	1410	1456	7.12e-11	SMART
EGF_Lam	1459	1513	3.25e-5	SMART
EGF_like	1497	1547	6.41e1	SMART
EGF_Lam	1516	1560	1.71e-13	SMART
Pfam:Laminin_I	1574	1838	1.7e-91	PFAM
low complexity region	2012	2031	N/A	INTRINSIC
low complexity region	2087	2098	N/A	INTRINSIC
LamG	2145	2287	3.66e-30	SMART
LamG	2332	2473	5.98e-35	SMART
LamG	2513	2661	1.11e-29	SMART
low complexity region	2695	2708	N/A	INTRINSIC
LamG	2743	2877	9.72e-35	SMART
LamG	2920	3056	4.63e-41	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	A	T	9: 114,304,711		noncoding transcript	Het
6430548M08Rik	T	C	8: 120,160,414		probably null	Het
Abca4	G	A	3: 122,155,299	G531E	possibly damaging	Het
Acad8	A	G	9: 26,990,627	L147P	probably damaging	Het
Acot10	T	C	15: 20,665,942	S238G	probably benign	Het
Adamtsl2	A	T	2: 27,095,475	H457L	probably benign	Het
Ankrd35	A	T	3: 96,679,208	T67S	probably damaging	Het
Aox2	T	G	1: 58,334,694	I838S	possibly damaging	Het
Arnt2	T	C	7: 84,275,386	N411S	probably damaging	Het
Bmpr2	T	C	1: 59,867,716	L656S	probably damaging	Het
Carns1	A	T	19: 4,165,476	Y902*	probably null	Het
Cavin1	T	C	11: 100,958,796	E336G	probably damaging	Het
Cbl	A	T	9: 44,153,848	C728S	probably benign	Het
Ccdc136	C	A	6: 29,411,281	Q218K	probably damaging	Het
Cdk19	C	A	10: 40,466,710	T196K	probably damaging	Het
Ceacam20	T	C	7: 19,986,027	Y495H	probably damaging	Het
Celf2	T	C	2: 6,721,528	I47V	probably benign	Het
Ces3a	A	C	8: 105,053,423	K299T	probably damaging	Het
Cfap61	A	T	2: 146,143,136	I967F	probably damaging	Het
Cnksr1	C	T	4: 134,232,971		probably benign	Het
Cped1	T	C	6: 22,237,653	Y923H	probably benign	Het
Crip3	T	C	17: 46,429,364	L30P	probably damaging	Het
Csmd1	A	G	8: 16,023,891	I2030T	possibly damaging	Het
Ctse	C	A	1: 131,662,749	P70T	probably damaging	Het
Cyp2b23	A	G	7: 26,672,734	F429L	probably damaging	Het
Cyp2c66	T	A	19: 39,176,656	D360E	probably damaging	Het
D8Ertd738e	A	T	8: 84,249,481	L46*	probably null	Het
Dcp2	T	A	18: 44,415,362		probably null	Het
Ddx10	C	A	9: 53,099,213	D834Y	possibly damaging	Het
Ddx19a	A	T	8: 110,979,084	V245E	probably damaging	Het
Dpf2	A	C	19: 5,904,487	D130E	probably benign	Het
Emc8	A	T	8: 120,667,779	M67K	probably damaging	Het
Ephb6	T	C	6: 41,614,602	L231P	possibly damaging	Het
Erp27	T	C	6: 136,908,152	E216G	possibly damaging	Het
Esco1	A	T	18: 10,594,734	I184N	possibly damaging	Het
Fam205c	A	G	4: 42,871,608	F256L	probably benign	Het
Fdxacb1	T	A	9: 50,770,260	D11E	possibly damaging	Het
Fhod3	C	T	18: 25,066,338	P689S	probably benign	Het
Fnip1	T	A	11: 54,503,559	S940R	probably damaging	Het
Ganc	G	T	2: 120,431,067	V343F	probably benign	Het
Gldn	T	A	9: 54,332,018	L228*	probably null	Het
Gm1123	C	T	9: 99,009,373	R341H	probably damaging	Het
Gtf2f2	T	C	14: 75,917,638	Y161C	probably benign	Het
Gtf3c1	T	C	7: 125,667,338	T979A	probably damaging	Het
Hist1h4a	A	G	13: 23,760,976	V61A	probably benign	Het
Hmcn2	G	T	2: 31,435,792	R4277L	probably benign	Het
Hsd17b6	T	A	10: 127,994,426		probably null	Het
Igkv12-46	T	C	6: 69,764,797	T25A	probably damaging	Het
Inpp5e	G	A	2: 26,400,994	R354C	probably damaging	Het
Jcad	T	A	18: 4,680,221		probably null	Het
Kcna10	G	T	3: 107,194,694	A214S	possibly damaging	Het
Kit	T	C	5: 75,641,220		probably null	Het
Kmt2a	G	A	9: 44,824,572		probably benign	Het
Mesd	T	C	7: 83,895,756	V138A	probably damaging	Het
Mmp13	T	C	9: 7,272,580	F9S	possibly damaging	Het
Mocos	T	C	18: 24,666,434	Y242H	probably benign	Het
Mrc1	A	C	2: 14,293,486	T718P	probably damaging	Het
Msh6	T	C	17: 87,984,806	S330P	possibly damaging	Het
Myh10	A	G	11: 68,804,642	K1532E	probably damaging	Het
Nat9	T	C	11: 115,184,542	N91S	probably damaging	Het
Neto2	A	T	8: 85,641,062	I351N	probably damaging	Het
Nfx1	A	G	4: 40,976,367	N14D	possibly damaging	Het
Nlrp4b	A	G	7: 10,714,733	T288A	possibly damaging	Het
Nutm2	C	A	13: 50,472,997	T396K	probably benign	Het
Ogdhl	A	G	14: 32,332,536	T196A	probably benign	Het
Olfr1453	A	T	19: 13,028,081	F83I	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,604	I223V	possibly damaging	Het
Olfr582	A	T	7: 103,041,851	D119V	probably benign	Het
Omg	T	A	11: 79,502,423	N203I	probably damaging	Het
Pdgfrb	A	G	18: 61,064,113	Y207C	probably damaging	Het
Pdzd7	T	A	19: 45,045,687		probably benign	Het
Pgs1	C	A	11: 118,003,507	H157N	probably damaging	Het
Pik3c2a	A	G	7: 116,358,688	V1121A	probably benign	Het
Pikfyve	T	A	1: 65,250,273	C1235S	probably damaging	Het
Pms1	G	A	1: 53,189,474	Q872*	probably null	Het
Ptgs2	A	G	1: 150,101,084	T23A	probably benign	Het
Rgl1	T	G	1: 152,521,371	R716S	probably damaging	Het
Rif1	A	G	2: 52,111,952	E1806G	probably benign	Het
Ripor1	T	C	8: 105,614,652	V39A	probably benign	Het
Ryr2	G	T	13: 11,593,117	T868N	probably benign	Het
Sec22b	A	T	3: 97,921,122	D167V	probably damaging	Het
Sec24d	T	C	3: 123,355,774	V810A	probably damaging	Het
Shh	T	C	5: 28,457,855	*438W	probably null	Het
Slc25a12	G	A	2: 71,315,062	S178L	probably benign	Het
Sorl1	A	T	9: 41,984,508	W1784R	probably damaging	Het
Sp3	A	T	2: 72,970,981	S229R	probably damaging	Het
Spdye4c	G	A	2: 128,592,353	V5I	possibly damaging	Het
Spint2	A	T	7: 29,260,379	V53D	probably damaging	Het
Stard3nl	T	A	13: 19,376,519	N29Y	probably damaging	Het
Stk25	A	G	1: 93,625,483	S299P	probably damaging	Het
Sult2a3	A	G	7: 14,122,861	S45P	probably damaging	Het
Thsd7a	A	T	6: 12,408,968	V685E	probably damaging	Het
Tm9sf4	T	A	2: 153,187,308	V92D	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Topors	G	A	4: 40,262,669	T205I	probably damaging	Het
Tpo	T	A	12: 30,103,290	Y355F	probably benign	Het
Uba1y	T	A	Y: 826,032	M396K	possibly damaging	Het
Vmn1r50	A	T	6: 90,107,531	Q86L	probably benign	Het
Vmn1r77	A	G	7: 12,041,431	K45E	probably damaging	Het
Vmn2r114	A	C	17: 23,310,473	N218K	possibly damaging	Het
Vmn2r66	T	A	7: 84,994,697	N835I	probably damaging	Het
Vps54	T	G	11: 21,299,989	N458K	probably benign	Het
Zcchc7	G	T	4: 44,895,964	C304F	probably damaging	Het
Zfp335	A	T	2: 164,900,286	C593S	probably damaging	Het
Zmynd15	C	G	11: 70,462,588	P214R	probably damaging	Het

Other mutations in Lama1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Lama1	APN	17	67815928	missense	probably benign
IGL00336:Lama1	APN	17	67813948	missense	probably benign	0.07
IGL01066:Lama1	APN	17	67743326	missense	probably damaging	1.00
IGL01140:Lama1	APN	17	67802933	missense	probably benign	0.14
IGL01291:Lama1	APN	17	67738870	missense	probably damaging	1.00
IGL01296:Lama1	APN	17	67745051	missense	probably benign	0.27
IGL01317:Lama1	APN	17	67818701	missense	probably damaging	1.00
IGL01490:Lama1	APN	17	67750584	missense	possibly damaging	0.54
IGL01506:Lama1	APN	17	67785070	missense	probably benign	0.01
IGL01508:Lama1	APN	17	67809361	splice site	probably benign
IGL01522:Lama1	APN	17	67752774	splice site	probably benign
IGL01530:Lama1	APN	17	67796790	missense	probably benign	0.02
IGL01541:Lama1	APN	17	67785070	missense	probably benign	0.01
IGL01677:Lama1	APN	17	67779148	missense	probably benign	0.15
IGL01886:Lama1	APN	17	67807797	missense	probably benign	0.36
IGL01994:Lama1	APN	17	67752439	missense	probably benign	0.05
IGL02017:Lama1	APN	17	67764725	missense	probably benign	0.00
IGL02021:Lama1	APN	17	67821626	missense	probably damaging	1.00
IGL02026:Lama1	APN	17	67809292	missense	possibly damaging	0.82
IGL02044:Lama1	APN	17	67811490	missense	probably benign	0.01
IGL02120:Lama1	APN	17	67716789	missense	probably damaging	1.00
IGL02425:Lama1	APN	17	67811485	missense	probably benign	0.45
IGL02549:Lama1	APN	17	67790835	missense	possibly damaging	0.93
IGL02642:Lama1	APN	17	67812366	missense	probably benign	0.00
IGL02795:Lama1	APN	17	67738894	splice site	probably null
IGL02798:Lama1	APN	17	67795191	splice site	probably benign
IGL02863:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02870:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02876:Lama1	APN	17	67750692	critical splice donor site	probably null
IGL02885:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02891:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02978:Lama1	APN	17	67786081	nonsense	probably null
IGL03064:Lama1	APN	17	67779104	missense	probably benign	0.01
IGL03076:Lama1	APN	17	67716799	missense	possibly damaging	0.95
IGL03110:Lama1	APN	17	67798986	missense	probably benign	0.04
IGL03143:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL03159:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL03268:Lama1	APN	17	67804536	missense	probably damaging	0.99
ANU05:Lama1	UTSW	17	67738870	missense	probably damaging	1.00
PIT4472001:Lama1	UTSW	17	67764704	missense
R0047:Lama1	UTSW	17	67795186	splice site	probably benign
R0047:Lama1	UTSW	17	67795186	splice site	probably benign
R0050:Lama1	UTSW	17	67782056	missense	possibly damaging	0.66
R0096:Lama1	UTSW	17	67805413	missense	probably benign	0.12
R0096:Lama1	UTSW	17	67805413	missense	probably benign	0.12
R0111:Lama1	UTSW	17	67737498	missense	probably damaging	0.98
R0116:Lama1	UTSW	17	67776923	missense	probably benign	0.10
R0121:Lama1	UTSW	17	67798513	splice site	probably benign
R0278:Lama1	UTSW	17	67810183	missense	probably null	0.98
R0281:Lama1	UTSW	17	67817569	missense	probably damaging	1.00
R0312:Lama1	UTSW	17	67775851	missense	possibly damaging	0.45
R0419:Lama1	UTSW	17	67791610	critical splice donor site	probably null
R0512:Lama1	UTSW	17	67779134	missense	possibly damaging	0.67
R0514:Lama1	UTSW	17	67764698	missense	probably benign	0.40
R0562:Lama1	UTSW	17	67815959	missense	probably damaging	1.00
R0632:Lama1	UTSW	17	67752368	splice site	probably benign
R0645:Lama1	UTSW	17	67773712	missense	probably benign	0.01
R0712:Lama1	UTSW	17	67779042	splice site	probably null
R0763:Lama1	UTSW	17	67772818	missense	probably damaging	0.97
R0941:Lama1	UTSW	17	67775865	missense	probably benign	0.10
R1025:Lama1	UTSW	17	67752898	missense	probably benign	0.00
R1084:Lama1	UTSW	17	67804469	missense	probably benign	0.12
R1103:Lama1	UTSW	17	67790947	missense	probably damaging	0.98
R1420:Lama1	UTSW	17	67790947	missense	probably damaging	0.98
R1430:Lama1	UTSW	17	67782155	missense	possibly damaging	0.95
R1569:Lama1	UTSW	17	67780618	splice site	probably null
R1575:Lama1	UTSW	17	67810409	missense	possibly damaging	0.96
R1613:Lama1	UTSW	17	67807923	missense	probably benign	0.42
R1620:Lama1	UTSW	17	67767033	missense	probably benign	0.01
R1629:Lama1	UTSW	17	67805428	missense	probably benign	0.00
R1645:Lama1	UTSW	17	67737682	missense	probably benign	0.14
R1652:Lama1	UTSW	17	67807846	missense	probably damaging	0.97
R1674:Lama1	UTSW	17	67791244	missense	probably benign
R1678:Lama1	UTSW	17	67810155	missense	possibly damaging	0.56
R1710:Lama1	UTSW	17	67753791	missense	probably benign	0.00
R1712:Lama1	UTSW	17	67717186	missense	possibly damaging	0.95
R1737:Lama1	UTSW	17	67802921	missense	probably benign	0.36
R1757:Lama1	UTSW	17	67763836	missense	probably benign	0.40
R1757:Lama1	UTSW	17	67697383	missense	unknown
R1813:Lama1	UTSW	17	67791223	missense	probably benign
R1896:Lama1	UTSW	17	67791223	missense	probably benign
R1945:Lama1	UTSW	17	67745853	missense	probably benign	0.14
R2086:Lama1	UTSW	17	67817623	missense	probably damaging	1.00
R2149:Lama1	UTSW	17	67773865	missense	possibly damaging	0.95
R2178:Lama1	UTSW	17	67769515	missense	probably benign	0.07
R2183:Lama1	UTSW	17	67791009	missense	probably damaging	0.98
R2197:Lama1	UTSW	17	67752941	missense	probably benign	0.02
R2213:Lama1	UTSW	17	67777034	nonsense	probably null
R2260:Lama1	UTSW	17	67737507	missense	probably damaging	0.96
R2356:Lama1	UTSW	17	67810114	missense	probably damaging	1.00
R2420:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2421:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2422:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2424:Lama1	UTSW	17	67798665	missense	probably benign	0.09
R2442:Lama1	UTSW	17	67768317	missense	probably benign	0.04
R3147:Lama1	UTSW	17	67737658	missense	probably damaging	0.98
R3414:Lama1	UTSW	17	67737603	missense	probably damaging	1.00
R3683:Lama1	UTSW	17	67768333	missense	probably benign	0.40
R3820:Lama1	UTSW	17	67779046	splice site	probably null
R3821:Lama1	UTSW	17	67779046	splice site	probably null
R3822:Lama1	UTSW	17	67779046	splice site	probably null
R4012:Lama1	UTSW	17	67812373	nonsense	probably null
R4113:Lama1	UTSW	17	67764703	missense	probably benign	0.01
R4133:Lama1	UTSW	17	67750655	missense	probably damaging	0.98
R4133:Lama1	UTSW	17	67812486	missense	probably damaging	1.00
R4259:Lama1	UTSW	17	67752418	missense	possibly damaging	0.95
R4278:Lama1	UTSW	17	67791517	missense	probably null	0.00
R4321:Lama1	UTSW	17	67771083	missense	probably benign	0.03
R4374:Lama1	UTSW	17	67804518	missense	probably benign	0.00
R4386:Lama1	UTSW	17	67773712	missense	probably benign	0.01
R4463:Lama1	UTSW	17	67761700	missense	probably damaging	1.00
R4629:Lama1	UTSW	17	67805360	critical splice acceptor site	probably null
R4630:Lama1	UTSW	17	67794300	missense	probably benign	0.00
R4633:Lama1	UTSW	17	67798584	missense	probably damaging	0.96
R4684:Lama1	UTSW	17	67773778	missense	possibly damaging	0.88
R4745:Lama1	UTSW	17	67738780	missense	probably damaging	1.00
R4786:Lama1	UTSW	17	67773859	missense	possibly damaging	0.77
R4797:Lama1	UTSW	17	67716775	missense	probably benign	0.04
R4803:Lama1	UTSW	17	67809271	missense	probably damaging	1.00
R4925:Lama1	UTSW	17	67794314	missense	probably benign	0.02
R4939:Lama1	UTSW	17	67737475	missense	possibly damaging	0.91
R4952:Lama1	UTSW	17	67767566	critical splice donor site	probably null
R4975:Lama1	UTSW	17	67738834	missense	possibly damaging	0.95
R4977:Lama1	UTSW	17	67737682	missense	probably damaging	1.00
R5039:Lama1	UTSW	17	67745893	missense	possibly damaging	0.66
R5047:Lama1	UTSW	17	67743281	nonsense	probably null
R5195:Lama1	UTSW	17	67764800	missense	probably benign	0.13
R5230:Lama1	UTSW	17	67745083	nonsense	probably null
R5236:Lama1	UTSW	17	67804492	missense	probably benign	0.24
R5254:Lama1	UTSW	17	67756716	missense	probably benign	0.01
R5345:Lama1	UTSW	17	67817563	missense	probably benign
R5438:Lama1	UTSW	17	67800774	missense	possibly damaging	0.92
R5521:Lama1	UTSW	17	67780894	nonsense	probably null
R5568:Lama1	UTSW	17	67768298	critical splice acceptor site	probably null
R5645:Lama1	UTSW	17	67802948	missense	probably damaging	1.00
R5665:Lama1	UTSW	17	67770987	missense	probably damaging	1.00
R5727:Lama1	UTSW	17	67815224	missense	possibly damaging	0.81
R5757:Lama1	UTSW	17	67738787	missense	possibly damaging	0.59
R5795:Lama1	UTSW	17	67796727	missense	probably benign	0.02
R5857:Lama1	UTSW	17	67807843	missense	probably damaging	0.99
R5894:Lama1	UTSW	17	67779047	critical splice acceptor site	probably null
R5974:Lama1	UTSW	17	67773727	missense	probably benign	0.31
R6032:Lama1	UTSW	17	67750643	missense	probably benign	0.01
R6032:Lama1	UTSW	17	67750643	missense	probably benign	0.01
R6120:Lama1	UTSW	17	67780617	critical splice donor site	probably null
R6219:Lama1	UTSW	17	67790856	missense	probably benign	0.08
R6224:Lama1	UTSW	17	67802987	missense	possibly damaging	0.56
R6249:Lama1	UTSW	17	67798604	missense	probably benign
R6265:Lama1	UTSW	17	67750655	missense	probably damaging	0.98
R6276:Lama1	UTSW	17	67784088	splice site	probably null
R6284:Lama1	UTSW	17	67810096	missense	probably damaging	0.99
R6337:Lama1	UTSW	17	67786019	missense	probably benign	0.27
R6414:Lama1	UTSW	17	67746910	critical splice donor site	probably null
R6631:Lama1	UTSW	17	67774482	missense	probably benign	0.21
R6659:Lama1	UTSW	17	67818635	missense	probably damaging	1.00
R6660:Lama1	UTSW	17	67804500	missense	probably benign	0.05
R6677:Lama1	UTSW	17	67795233	missense	probably benign	0.14
R6763:Lama1	UTSW	17	67746873	missense	unknown
R6787:Lama1	UTSW	17	67784025	missense	unknown
R6831:Lama1	UTSW	17	67756754	missense	possibly damaging	0.89
R6855:Lama1	UTSW	17	67782155	missense	possibly damaging	0.95
R6910:Lama1	UTSW	17	67791464	missense	possibly damaging	0.60
R6934:Lama1	UTSW	17	67774543	missense	probably benign	0.04
R6945:Lama1	UTSW	17	67813866	missense
R6984:Lama1	UTSW	17	67779112	missense
R6989:Lama1	UTSW	17	67753758	missense
R6994:Lama1	UTSW	17	67753825	missense
R6995:Lama1	UTSW	17	67753825	missense
R7035:Lama1	UTSW	17	67781049	missense
R7133:Lama1	UTSW	17	67782146	missense
R7172:Lama1	UTSW	17	67804545	missense
R7197:Lama1	UTSW	17	67737705	nonsense	probably null
R7217:Lama1	UTSW	17	67764673	missense
R7229:Lama1	UTSW	17	67752446	missense
R7264:Lama1	UTSW	17	67743297	missense
R7311:Lama1	UTSW	17	67767385	missense
R7394:Lama1	UTSW	17	67717261	missense
R7419:Lama1	UTSW	17	67717174	missense
R7460:Lama1	UTSW	17	67767018	missense
R7492:Lama1	UTSW	17	67817651	missense
R7494:Lama1	UTSW	17	67811446	missense
R7552:Lama1	UTSW	17	67737667	missense
R7576:Lama1	UTSW	17	67782041	missense
R7583:Lama1	UTSW	17	67761621	missense
R7649:Lama1	UTSW	17	67737554	missense
R7663:Lama1	UTSW	17	67780880	missense
R7667:Lama1	UTSW	17	67780597	missense
R7688:Lama1	UTSW	17	67761628	missense
R7693:Lama1	UTSW	17	67817031	missense
R7748:Lama1	UTSW	17	67750590	missense
R7778:Lama1	UTSW	17	67804473	missense
R7824:Lama1	UTSW	17	67804473	missense
R7861:Lama1	UTSW	17	67809221	missense
R7884:Lama1	UTSW	17	67769435	missense
R8029:Lama1	UTSW	17	67817594	missense
R8078:Lama1	UTSW	17	67791294	missense
R8101:Lama1	UTSW	17	67745922	missense
R8313:Lama1	UTSW	17	67750520	missense
R8356:Lama1	UTSW	17	67737496	missense
R8366:Lama1	UTSW	17	67818704	missense
R8403:Lama1	UTSW	17	67745923	missense
R8456:Lama1	UTSW	17	67737496	missense
R8466:Lama1	UTSW	17	67813953	missense
R8678:Lama1	UTSW	17	67817103	missense
R8728:Lama1	UTSW	17	67818668	missense
R8796:Lama1	UTSW	17	67810151	missense
R8885:Lama1	UTSW	17	67773784	missense
R8893:Lama1	UTSW	17	67805372	missense
R8898:Lama1	UTSW	17	67821615	missense
R8909:Lama1	UTSW	17	67772741	missense
R9025:Lama1	UTSW	17	67812496	missense
R9045:Lama1	UTSW	17	67753843	missense
R9098:Lama1	UTSW	17	67804513	missense
R9114:Lama1	UTSW	17	67821674	missense
R9173:Lama1	UTSW	17	67769602	missense
R9190:Lama1	UTSW	17	67804519	missense
R9381:Lama1	UTSW	17	67737484	missense
R9429:Lama1	UTSW	17	67811454	missense
R9504:Lama1	UTSW	17	67821666	missense
R9558:Lama1	UTSW	17	67817009	missense
R9647:Lama1	UTSW	17	67717175	missense
R9651:Lama1	UTSW	17	67794220	missense
R9654:Lama1	UTSW	17	67794271	missense
R9710:Lama1	UTSW	17	67822409	missense
R9733:Lama1	UTSW	17	67809945	missense
RF001:Lama1	UTSW	17	67752902	missense
RF013:Lama1	UTSW	17	67781062	missense
V8831:Lama1	UTSW	17	67752883	missense	probably benign	0.00
X0024:Lama1	UTSW	17	67738888	missense	probably damaging	1.00
X0028:Lama1	UTSW	17	67767422	missense	probably benign	0.00
X0028:Lama1	UTSW	17	67794310	missense	probably benign	0.06
X0066:Lama1	UTSW	17	67811566	missense	probably damaging	1.00
Z1088:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1088:Lama1	UTSW	17	67771082	missense	probably benign	0.25
Z1088:Lama1	UTSW	17	67810171	missense	probably damaging	1.00
Z1176:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1177:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1191:Lama1	UTSW	17	67798644	missense

Predicted Primers

PCR Primer
(F):5'- TGTTTACCTTGGAGACTTGTAGAAG -3'
(R):5'- AGGTGGCAGTTGACTGAACTC -3'

Sequencing Primer
(F):5'- ATGCCTTGAAGTGTGAATTTCTTTC -3'
(R):5'- GGCAGTTGACTGAACTCTTTATTTC -3'

Posted On

2015-10-08