Incidental Mutation 'R4668:Cyp2c66'
ID 352212
Institutional Source Beutler Lab
Gene Symbol Cyp2c66
Ensembl Gene ENSMUSG00000067229
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms 2010301M18Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R4668 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 39102342-39175200 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39165100 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 360 (D360E)
Ref Sequence ENSEMBL: ENSMUSP00000084487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087234] [ENSMUST00000146494]
AlphaFold Q5GLZ0
Predicted Effect probably damaging
Transcript: ENSMUST00000087234
AA Change: D360E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084487
Gene: ENSMUSG00000067229
AA Change: D360E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146494
SMART Domains Protein: ENSMUSP00000120397
Gene: ENSMUSG00000067229

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1cpt__ 26 55 4e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A T 9: 114,133,779 (GRCm39) noncoding transcript Het
6430548M08Rik T C 8: 120,887,153 (GRCm39) probably null Het
Abca4 G A 3: 121,948,948 (GRCm39) G531E possibly damaging Het
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Acot10 T C 15: 20,666,028 (GRCm39) S238G probably benign Het
Adamtsl2 A T 2: 26,985,487 (GRCm39) H457L probably benign Het
Ankrd35 A T 3: 96,586,524 (GRCm39) T67S probably damaging Het
Aox1 T G 1: 58,373,853 (GRCm39) I838S possibly damaging Het
Arnt2 T C 7: 83,924,594 (GRCm39) N411S probably damaging Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Carns1 A T 19: 4,215,475 (GRCm39) Y902* probably null Het
Cavin1 T C 11: 100,849,622 (GRCm39) E336G probably damaging Het
Cbl A T 9: 44,065,145 (GRCm39) C728S probably benign Het
Ccdc136 C A 6: 29,411,280 (GRCm39) Q218K probably damaging Het
Cdk19 C A 10: 40,342,706 (GRCm39) T196K probably damaging Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Ces3a A C 8: 105,780,055 (GRCm39) K299T probably damaging Het
Cfap61 A T 2: 145,985,056 (GRCm39) I967F probably damaging Het
Cnksr1 C T 4: 133,960,282 (GRCm39) probably benign Het
Cped1 T C 6: 22,237,652 (GRCm39) Y923H probably benign Het
Crip3 T C 17: 46,740,290 (GRCm39) L30P probably damaging Het
Csmd1 A G 8: 16,073,905 (GRCm39) I2030T possibly damaging Het
Ctse C A 1: 131,590,487 (GRCm39) P70T probably damaging Het
Cyp2b23 A G 7: 26,372,159 (GRCm39) F429L probably damaging Het
D8Ertd738e A T 8: 84,976,110 (GRCm39) L46* probably null Het
Dcp2 T A 18: 44,548,429 (GRCm39) probably null Het
Ddx10 C A 9: 53,010,513 (GRCm39) D834Y possibly damaging Het
Ddx19a A T 8: 111,705,716 (GRCm39) V245E probably damaging Het
Dpf2 A C 19: 5,954,515 (GRCm39) D130E probably benign Het
Emc8 A T 8: 121,394,518 (GRCm39) M67K probably damaging Het
Ephb6 T C 6: 41,591,536 (GRCm39) L231P possibly damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
Esco1 A T 18: 10,594,734 (GRCm39) I184N possibly damaging Het
Fdxacb1 T A 9: 50,681,560 (GRCm39) D11E possibly damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnip1 T A 11: 54,394,385 (GRCm39) S940R probably damaging Het
Ganc G T 2: 120,261,548 (GRCm39) V343F probably benign Het
Gldn T A 9: 54,239,302 (GRCm39) L228* probably null Het
Gm1123 C T 9: 98,891,426 (GRCm39) R341H probably damaging Het
Gtf2f2 T C 14: 76,155,078 (GRCm39) Y161C probably benign Het
Gtf3c1 T C 7: 125,266,510 (GRCm39) T979A probably damaging Het
H4c1 A G 13: 23,944,959 (GRCm39) V61A probably benign Het
Hmcn2 G T 2: 31,325,804 (GRCm39) R4277L probably benign Het
Hsd17b6 T A 10: 127,830,295 (GRCm39) probably null Het
Igkv12-46 T C 6: 69,741,781 (GRCm39) T25A probably damaging Het
Inpp5e G A 2: 26,291,006 (GRCm39) R354C probably damaging Het
Jcad T A 18: 4,680,221 (GRCm39) probably null Het
Kcna10 G T 3: 107,102,010 (GRCm39) A214S possibly damaging Het
Kit T C 5: 75,801,880 (GRCm39) probably null Het
Kmt2a G A 9: 44,735,869 (GRCm39) probably benign Het
Lama1 T C 17: 68,059,429 (GRCm39) V604A probably benign Het
Mesd T C 7: 83,544,964 (GRCm39) V138A probably damaging Het
Mmp13 T C 9: 7,272,580 (GRCm39) F9S possibly damaging Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Mrc1 A C 2: 14,298,297 (GRCm39) T718P probably damaging Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Myh10 A G 11: 68,695,468 (GRCm39) K1532E probably damaging Het
Nat9 T C 11: 115,075,368 (GRCm39) N91S probably damaging Het
Neto2 A T 8: 86,367,691 (GRCm39) I351N probably damaging Het
Nfx1 A G 4: 40,976,367 (GRCm39) N14D possibly damaging Het
Nlrp4b A G 7: 10,448,660 (GRCm39) T288A possibly damaging Het
Nutm2 C A 13: 50,627,033 (GRCm39) T396K probably benign Het
Ogdhl A G 14: 32,054,493 (GRCm39) T196A probably benign Het
Omg T A 11: 79,393,249 (GRCm39) N203I probably damaging Het
Or52b4i A G 7: 102,191,811 (GRCm39) I223V possibly damaging Het
Or52r1b A T 7: 102,691,058 (GRCm39) D119V probably benign Het
Or5b101 A T 19: 13,005,445 (GRCm39) F83I probably benign Het
Pdgfrb A G 18: 61,197,185 (GRCm39) Y207C probably damaging Het
Pdzd7 T A 19: 45,034,126 (GRCm39) probably benign Het
Pgs1 C A 11: 117,894,333 (GRCm39) H157N probably damaging Het
Pik3c2a A G 7: 115,957,923 (GRCm39) V1121A probably benign Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Pms1 G A 1: 53,228,633 (GRCm39) Q872* probably null Het
Ptgs2 A G 1: 149,976,835 (GRCm39) T23A probably benign Het
Rgl1 T G 1: 152,397,122 (GRCm39) R716S probably damaging Het
Rif1 A G 2: 52,001,964 (GRCm39) E1806G probably benign Het
Ripor1 T C 8: 106,341,284 (GRCm39) V39A probably benign Het
Ryr2 G T 13: 11,608,003 (GRCm39) T868N probably benign Het
Sec22b A T 3: 97,828,438 (GRCm39) D167V probably damaging Het
Sec24d T C 3: 123,149,423 (GRCm39) V810A probably damaging Het
Shh T C 5: 28,662,853 (GRCm39) *438W probably null Het
Slc25a12 G A 2: 71,145,406 (GRCm39) S178L probably benign Het
Sorl1 A T 9: 41,895,804 (GRCm39) W1784R probably damaging Het
Sp3 A T 2: 72,801,325 (GRCm39) S229R probably damaging Het
Spata31f3 A G 4: 42,871,608 (GRCm39) F256L probably benign Het
Spdye4c G A 2: 128,434,273 (GRCm39) V5I possibly damaging Het
Spint2 A T 7: 28,959,804 (GRCm39) V53D probably damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Stk25 A G 1: 93,553,205 (GRCm39) S299P probably damaging Het
Sult2a3 A G 7: 13,856,786 (GRCm39) S45P probably damaging Het
Thsd7a A T 6: 12,408,967 (GRCm39) V685E probably damaging Het
Tm9sf4 T A 2: 153,029,228 (GRCm39) V92D probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Topors G A 4: 40,262,669 (GRCm39) T205I probably damaging Het
Tpo T A 12: 30,153,289 (GRCm39) Y355F probably benign Het
Uba1y T A Y: 826,032 (GRCm39) M396K possibly damaging Het
Vmn1r50 A T 6: 90,084,513 (GRCm39) Q86L probably benign Het
Vmn1r77 A G 7: 11,775,358 (GRCm39) K45E probably damaging Het
Vmn2r114 A C 17: 23,529,447 (GRCm39) N218K possibly damaging Het
Vmn2r66 T A 7: 84,643,905 (GRCm39) N835I probably damaging Het
Vps54 T G 11: 21,249,989 (GRCm39) N458K probably benign Het
Zcchc7 G T 4: 44,895,964 (GRCm39) C304F probably damaging Het
Zfp335 A T 2: 164,742,206 (GRCm39) C593S probably damaging Het
Zmynd15 C G 11: 70,353,414 (GRCm39) P214R probably damaging Het
Other mutations in Cyp2c66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Cyp2c66 APN 19 39,159,405 (GRCm39) missense probably benign 0.00
IGL01589:Cyp2c66 APN 19 39,172,379 (GRCm39) critical splice donor site probably null
IGL02098:Cyp2c66 APN 19 39,159,473 (GRCm39) missense probably damaging 1.00
IGL02114:Cyp2c66 APN 19 39,159,519 (GRCm39) splice site probably benign
IGL02567:Cyp2c66 APN 19 39,175,084 (GRCm39) utr 3 prime probably benign
IGL03181:Cyp2c66 APN 19 39,130,483 (GRCm39) missense probably benign 0.00
IGL03230:Cyp2c66 APN 19 39,172,302 (GRCm39) missense possibly damaging 0.91
R0007:Cyp2c66 UTSW 19 39,159,402 (GRCm39) nonsense probably null
R0092:Cyp2c66 UTSW 19 39,172,224 (GRCm39) splice site probably benign
R0242:Cyp2c66 UTSW 19 39,130,369 (GRCm39) missense probably damaging 1.00
R0242:Cyp2c66 UTSW 19 39,130,369 (GRCm39) missense probably damaging 1.00
R0324:Cyp2c66 UTSW 19 39,165,135 (GRCm39) missense probably benign 0.27
R0675:Cyp2c66 UTSW 19 39,175,060 (GRCm39) missense possibly damaging 0.93
R1127:Cyp2c66 UTSW 19 39,151,812 (GRCm39) missense probably damaging 1.00
R1871:Cyp2c66 UTSW 19 39,151,858 (GRCm39) missense possibly damaging 0.66
R3404:Cyp2c66 UTSW 19 39,151,771 (GRCm39) missense probably benign
R3429:Cyp2c66 UTSW 19 39,151,892 (GRCm39) missense probably damaging 0.97
R3896:Cyp2c66 UTSW 19 39,130,722 (GRCm39) missense possibly damaging 0.82
R4115:Cyp2c66 UTSW 19 39,165,003 (GRCm39) missense possibly damaging 0.66
R4116:Cyp2c66 UTSW 19 39,165,003 (GRCm39) missense possibly damaging 0.66
R4667:Cyp2c66 UTSW 19 39,165,100 (GRCm39) missense probably damaging 1.00
R4711:Cyp2c66 UTSW 19 39,151,843 (GRCm39) missense possibly damaging 0.74
R4960:Cyp2c66 UTSW 19 39,151,766 (GRCm39) critical splice acceptor site probably null
R5070:Cyp2c66 UTSW 19 39,151,914 (GRCm39) missense probably benign 0.15
R5113:Cyp2c66 UTSW 19 39,151,882 (GRCm39) missense probably benign 0.00
R5125:Cyp2c66 UTSW 19 39,159,473 (GRCm39) missense probably damaging 1.00
R5178:Cyp2c66 UTSW 19 39,159,473 (GRCm39) missense probably damaging 1.00
R5588:Cyp2c66 UTSW 19 39,151,858 (GRCm39) missense possibly damaging 0.66
R6011:Cyp2c66 UTSW 19 39,130,380 (GRCm39) missense probably benign 0.00
R6497:Cyp2c66 UTSW 19 39,151,821 (GRCm39) missense probably damaging 0.96
R6707:Cyp2c66 UTSW 19 39,174,944 (GRCm39) missense probably damaging 1.00
R7173:Cyp2c66 UTSW 19 39,159,401 (GRCm39) missense probably benign 0.01
R7202:Cyp2c66 UTSW 19 39,130,348 (GRCm39) missense probably damaging 1.00
R7469:Cyp2c66 UTSW 19 39,172,307 (GRCm39) missense probably damaging 1.00
R7614:Cyp2c66 UTSW 19 39,159,472 (GRCm39) missense probably damaging 0.98
R7985:Cyp2c66 UTSW 19 39,102,430 (GRCm39) missense probably null 1.00
R8012:Cyp2c66 UTSW 19 39,172,369 (GRCm39) missense probably damaging 1.00
R8056:Cyp2c66 UTSW 19 39,130,485 (GRCm39) missense probably benign 0.00
R8302:Cyp2c66 UTSW 19 39,165,078 (GRCm39) missense probably damaging 1.00
R8329:Cyp2c66 UTSW 19 39,174,906 (GRCm39) nonsense probably null
R8365:Cyp2c66 UTSW 19 39,165,048 (GRCm39) missense probably benign 0.00
R8472:Cyp2c66 UTSW 19 39,165,021 (GRCm39) missense probably benign 0.03
R8502:Cyp2c66 UTSW 19 39,130,773 (GRCm39) missense probably benign 0.01
R8688:Cyp2c66 UTSW 19 39,151,884 (GRCm39) missense probably benign 0.00
R8715:Cyp2c66 UTSW 19 39,159,388 (GRCm39) missense probably benign 0.01
R9199:Cyp2c66 UTSW 19 39,130,800 (GRCm39) missense probably benign 0.16
R9551:Cyp2c66 UTSW 19 39,172,246 (GRCm39) missense probably damaging 0.99
R9552:Cyp2c66 UTSW 19 39,172,246 (GRCm39) missense probably damaging 0.99
R9601:Cyp2c66 UTSW 19 39,175,054 (GRCm39) missense probably benign
R9777:Cyp2c66 UTSW 19 39,102,520 (GRCm39) missense probably benign 0.15
Z1177:Cyp2c66 UTSW 19 39,175,070 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCAGTGTGCCAATTCATTC -3'
(R):5'- GGCTTAATCTCCTAATTTCTCTGAAGG -3'

Sequencing Primer
(F):5'- AGTGTGCCAATTCATTCCATTTCTG -3'
(R):5'- ATTGGTAATCTGGAAATTGCAAGAC -3'
Posted On 2015-10-08