Incidental Mutation 'R4669:Ganc'
ID352229
Institutional Source Beutler Lab
Gene Symbol Ganc
Ensembl Gene ENSMUSG00000062646
Gene Nameglucosidase, alpha; neutral C
Synonyms5830445O15Rik
MMRRC Submission 041925-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R4669 (G1)
Quality Score185
Status Not validated
Chromosome2
Chromosomal Location120403896-120461700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120431067 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 343 (V343F)
Ref Sequence ENSEMBL: ENSMUSP00000116898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135074]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000043755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132835
Predicted Effect probably benign
Transcript: ENSMUST00000135074
AA Change: V343F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646
AA Change: V343F

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Pfam:Gal_mutarotas_2 221 292 2.3e-21 PFAM
Pfam:Glyco_hydro_31 333 778 2.5e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152437
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Acan A G 7: 79,101,142 E464G probably benign Het
Agap1 A G 1: 89,837,806 probably null Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Ap2a1 A T 7: 44,902,919 probably benign Het
Arap3 T C 18: 37,996,254 D217G probably benign Het
Arl2 C A 19: 6,134,686 R179L probably damaging Het
Atg2a T A 19: 6,258,987 probably null Het
B3gat1 T A 9: 26,751,756 L6Q probably benign Het
Bcl10 A G 3: 145,930,572 N75S probably damaging Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Brms1l A G 12: 55,841,571 E48G possibly damaging Het
C2cd2l A T 9: 44,315,025 N414K possibly damaging Het
Capn2 C T 1: 182,470,780 C640Y probably benign Het
Ccdc153 G T 9: 44,245,724 R99M probably damaging Het
Ccdc51 A G 9: 109,090,962 N142S probably benign Het
Ccdc58 A G 16: 36,082,719 D27G probably damaging Het
Cdipt A G 7: 126,978,406 H108R possibly damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Cts3 C T 13: 61,566,823 E223K probably benign Het
Cyp2a22 T C 7: 26,937,855 D168G possibly damaging Het
Cyp2c67 T A 19: 39,643,654 H90L probably benign Het
Ddx4 T C 13: 112,622,244 Y261C probably damaging Het
Dnah17 T C 11: 118,074,293 T2308A probably benign Het
Dnah6 T C 6: 73,037,688 T3587A probably damaging Het
Dpy19l1 C T 9: 24,432,368 V494I possibly damaging Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Emilin3 T C 2: 160,910,797 I78V probably benign Het
Esam T A 9: 37,536,656 Y195* probably null Het
Extl3 T A 14: 65,076,296 N479I possibly damaging Het
Fat2 A G 11: 55,311,615 V211A probably benign Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gnmt A T 17: 46,726,299 C186* probably null Het
Gpr75 A T 11: 30,892,072 I326F probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-T23 G T 17: 36,031,798 D149E probably damaging Het
Hmcn2 G T 2: 31,435,792 R4277L probably benign Het
Irf9 C A 14: 55,605,766 H94N probably benign Het
Jhy T C 9: 40,961,153 N20S probably benign Het
Klf17 C A 4: 117,760,371 C263F probably damaging Het
Lama5 T C 2: 180,180,637 Y2881C probably damaging Het
Lig1 T G 7: 13,311,028 I882S probably damaging Het
Ltn1 A T 16: 87,418,487 M420K possibly damaging Het
Mael T C 1: 166,235,508 E125G probably damaging Het
Mib2 C T 4: 155,657,415 D275N possibly damaging Het
Mical3 C T 6: 120,957,703 R1805Q probably damaging Het
Mllt10 A G 2: 18,203,633 D158G probably damaging Het
Mocs1 A G 17: 49,454,585 D569G possibly damaging Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtmr2 T C 9: 13,795,964 S199P probably damaging Het
Ndufaf5 T C 2: 140,187,755 V164A probably benign Het
Nek9 T C 12: 85,314,204 E518G probably benign Het
Nfatc2 T C 2: 168,571,490 I72V probably benign Het
Nlrp9c C T 7: 26,375,368 A746T possibly damaging Het
Nupl2 A G 5: 24,182,417 R402G probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfr1045 A T 2: 86,197,933 M273K possibly damaging Het
Olfr1225 G A 2: 89,170,901 H104Y probably damaging Het
Olfr146 T A 9: 39,019,379 Y54F probably benign Het
Olfr411 A G 11: 74,346,963 V207A probably benign Het
Olfr881 A T 9: 37,993,085 I198F possibly damaging Het
Otof A G 5: 30,420,974 probably null Het
Pcdhb17 T C 18: 37,486,206 S350P probably damaging Het
Phf3 T C 1: 30,829,946 T674A probably damaging Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Ppfia3 T C 7: 45,352,093 E465G probably damaging Het
Prkg1 T A 19: 31,664,239 I15F probably damaging Het
Rab5c A G 11: 100,720,017 F22L probably damaging Het
Raf1 A G 6: 115,632,919 S220P probably damaging Het
Rgl1 T G 1: 152,521,371 R716S probably damaging Het
Rhbg C A 3: 88,245,966 W205L probably damaging Het
Rimbp3 A G 16: 17,209,189 E159G possibly damaging Het
Ryr1 T C 7: 29,059,831 D3338G probably null Het
Sash1 T C 10: 8,730,385 N747S probably benign Het
Serpina3g A T 12: 104,239,220 I73F probably damaging Het
Sfxn2 C A 19: 46,585,774 N134K probably damaging Het
Slc12a6 A G 2: 112,354,295 H853R probably damaging Het
Slc16a12 C T 19: 34,672,565 D357N probably damaging Het
Slc39a8 T C 3: 135,856,011 Y164H probably benign Het
Snx9 A G 17: 5,927,224 K518E probably damaging Het
Spdye4c G A 2: 128,592,353 V5I possibly damaging Het
Spef2 A G 15: 9,676,373 V704A probably benign Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Strap C A 6: 137,735,386 S11* probably null Het
Synpo2 A G 3: 123,113,063 L868P probably damaging Het
Tenm2 A G 11: 36,010,487 V2474A probably damaging Het
Tm9sf4 T A 2: 153,187,308 V92D probably damaging Het
Tmf1 A T 6: 97,170,427 M526K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc39d A G 17: 80,217,639 I576V probably benign Het
Upk1a T G 7: 30,605,129 T193P probably benign Het
Vmn2r67 A T 7: 85,150,524 V502E probably benign Het
Wdr17 A G 8: 54,690,048 V189A possibly damaging Het
Wrap73 A T 4: 154,151,696 S161C probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Zfp605 T A 5: 110,127,361 M115K possibly damaging Het
Zp1 T A 19: 10,918,905 H152L probably benign Het
Other mutations in Ganc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ganc APN 2 120441598 missense probably damaging 1.00
IGL00913:Ganc APN 2 120439452 splice site probably benign
IGL01077:Ganc APN 2 120446515 missense possibly damaging 0.50
IGL01773:Ganc APN 2 120459884 missense possibly damaging 0.87
IGL01812:Ganc APN 2 120411526 missense probably benign 0.00
IGL02029:Ganc APN 2 120459857 missense probably benign 0.00
IGL02067:Ganc APN 2 120406304 missense probably benign 0.16
IGL02290:Ganc APN 2 120448423 missense possibly damaging 0.90
IGL02355:Ganc APN 2 120433757 missense probably damaging 1.00
IGL02362:Ganc APN 2 120433757 missense probably damaging 1.00
IGL02553:Ganc APN 2 120458134 missense probably benign
IGL02808:Ganc APN 2 120411511 missense probably benign 0.00
IGL02966:Ganc APN 2 120433648 missense probably damaging 1.00
IGL03356:Ganc APN 2 120435288 missense probably benign 0.22
IGL03405:Ganc APN 2 120433766 missense probably damaging 1.00
ingenuous UTSW 2 120444149 missense probably damaging 1.00
R0464:Ganc UTSW 2 120436694 missense probably benign 0.07
R0511:Ganc UTSW 2 120448401 nonsense probably null
R0932:Ganc UTSW 2 120458129 missense probably damaging 0.99
R1467:Ganc UTSW 2 120430928 splice site probably benign
R1902:Ganc UTSW 2 120446482 missense probably damaging 1.00
R2087:Ganc UTSW 2 120457257 missense probably damaging 1.00
R4668:Ganc UTSW 2 120431067 missense probably benign 0.02
R4725:Ganc UTSW 2 120435273 missense probably damaging 0.99
R4735:Ganc UTSW 2 120436623 splice site silent
R4738:Ganc UTSW 2 120452594 missense probably damaging 0.97
R4839:Ganc UTSW 2 120459823 missense probably benign
R4951:Ganc UTSW 2 120456047 missense probably benign 0.00
R5841:Ganc UTSW 2 120411539 missense possibly damaging 0.65
R5997:Ganc UTSW 2 120430605 missense possibly damaging 0.55
R6142:Ganc UTSW 2 120430737 critical splice donor site probably null
R6378:Ganc UTSW 2 120433826 missense probably damaging 1.00
R6711:Ganc UTSW 2 120450839 missense possibly damaging 0.74
R6777:Ganc UTSW 2 120444149 missense probably damaging 1.00
R7229:Ganc UTSW 2 120427775 missense possibly damaging 0.92
R7235:Ganc UTSW 2 120433717 missense probably damaging 1.00
R7241:Ganc UTSW 2 120441529 missense probably damaging 1.00
R7326:Ganc UTSW 2 120430599 missense probably damaging 1.00
R7567:Ganc UTSW 2 120456101 missense probably benign 0.01
R7685:Ganc UTSW 2 120433792 missense probably damaging 1.00
R7736:Ganc UTSW 2 120433814 missense possibly damaging 0.83
R7784:Ganc UTSW 2 120436668 nonsense probably null
R7955:Ganc UTSW 2 120430700 missense probably damaging 1.00
R8222:Ganc UTSW 2 120446452 missense probably damaging 1.00
R8247:Ganc UTSW 2 120436700 missense probably null 0.52
R8306:Ganc UTSW 2 120422079 missense probably benign 0.02
X0027:Ganc UTSW 2 120448450 missense probably damaging 1.00
Z1177:Ganc UTSW 2 120433794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCTACTAAACGTAGACCGAATC -3'
(R):5'- AGCCCTATTTACCTTGTCTGGATG -3'

Sequencing Primer
(F):5'- CGAATCACTTAAAACTGGGTGC -3'
(R):5'- CCTATTTACCTTGTCTGGATGTAATG -3'
Posted On2015-10-08