Incidental Mutation 'R4669:Synpo2'
ID352237
Institutional Source Beutler Lab
Gene Symbol Synpo2
Ensembl Gene ENSMUSG00000050315
Gene Namesynaptopodin 2
Synonyms1110069I04Rik, Myo, 9530006G20Rik, 2310068J10Rik, myopodin
MMRRC Submission 041925-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4669 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location123076519-123236149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123113063 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 868 (L868P)
Ref Sequence ENSEMBL: ENSMUSP00000142508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051443] [ENSMUST00000106426] [ENSMUST00000106427] [ENSMUST00000184590] [ENSMUST00000198584]
Predicted Effect probably damaging
Transcript: ENSMUST00000051443
AA Change: L538P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051570
Gene: ENSMUSG00000050315
AA Change: L538P

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106426
AA Change: L868P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102034
Gene: ENSMUSG00000050315
AA Change: L868P

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 4.61e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 2.92e-7 PROSPERO
internal_repeat_2 478 499 4.61e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 2.92e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
low complexity region 1196 1211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106427
AA Change: L868P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102035
Gene: ENSMUSG00000050315
AA Change: L868P

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 6.19e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 4.33e-7 PROSPERO
internal_repeat_2 478 499 6.19e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 4.33e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1137 1152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139160
SMART Domains Protein: ENSMUSP00000123396
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184590
SMART Domains Protein: ENSMUSP00000142426
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
low complexity region 141 158 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198584
AA Change: L868P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142508
Gene: ENSMUSG00000050315
AA Change: L868P

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Acan A G 7: 79,101,142 E464G probably benign Het
Agap1 A G 1: 89,837,806 probably null Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Ap2a1 A T 7: 44,902,919 probably benign Het
Arap3 T C 18: 37,996,254 D217G probably benign Het
Arl2 C A 19: 6,134,686 R179L probably damaging Het
Atg2a T A 19: 6,258,987 probably null Het
B3gat1 T A 9: 26,751,756 L6Q probably benign Het
Bcl10 A G 3: 145,930,572 N75S probably damaging Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Brms1l A G 12: 55,841,571 E48G possibly damaging Het
C2cd2l A T 9: 44,315,025 N414K possibly damaging Het
Capn2 C T 1: 182,470,780 C640Y probably benign Het
Ccdc153 G T 9: 44,245,724 R99M probably damaging Het
Ccdc51 A G 9: 109,090,962 N142S probably benign Het
Ccdc58 A G 16: 36,082,719 D27G probably damaging Het
Cdipt A G 7: 126,978,406 H108R possibly damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Cts3 C T 13: 61,566,823 E223K probably benign Het
Cyp2a22 T C 7: 26,937,855 D168G possibly damaging Het
Cyp2c67 T A 19: 39,643,654 H90L probably benign Het
Ddx4 T C 13: 112,622,244 Y261C probably damaging Het
Dnah17 T C 11: 118,074,293 T2308A probably benign Het
Dnah6 T C 6: 73,037,688 T3587A probably damaging Het
Dpy19l1 C T 9: 24,432,368 V494I possibly damaging Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Emilin3 T C 2: 160,910,797 I78V probably benign Het
Esam T A 9: 37,536,656 Y195* probably null Het
Extl3 T A 14: 65,076,296 N479I possibly damaging Het
Fat2 A G 11: 55,311,615 V211A probably benign Het
Ganc G T 2: 120,431,067 V343F probably benign Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gnmt A T 17: 46,726,299 C186* probably null Het
Gpr75 A T 11: 30,892,072 I326F probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-T23 G T 17: 36,031,798 D149E probably damaging Het
Hmcn2 G T 2: 31,435,792 R4277L probably benign Het
Irf9 C A 14: 55,605,766 H94N probably benign Het
Jhy T C 9: 40,961,153 N20S probably benign Het
Klf17 C A 4: 117,760,371 C263F probably damaging Het
Lama5 T C 2: 180,180,637 Y2881C probably damaging Het
Lig1 T G 7: 13,311,028 I882S probably damaging Het
Ltn1 A T 16: 87,418,487 M420K possibly damaging Het
Mael T C 1: 166,235,508 E125G probably damaging Het
Mib2 C T 4: 155,657,415 D275N possibly damaging Het
Mical3 C T 6: 120,957,703 R1805Q probably damaging Het
Mllt10 A G 2: 18,203,633 D158G probably damaging Het
Mocs1 A G 17: 49,454,585 D569G possibly damaging Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtmr2 T C 9: 13,795,964 S199P probably damaging Het
Ndufaf5 T C 2: 140,187,755 V164A probably benign Het
Nek9 T C 12: 85,314,204 E518G probably benign Het
Nfatc2 T C 2: 168,571,490 I72V probably benign Het
Nlrp9c C T 7: 26,375,368 A746T possibly damaging Het
Nupl2 A G 5: 24,182,417 R402G probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfr1045 A T 2: 86,197,933 M273K possibly damaging Het
Olfr1225 G A 2: 89,170,901 H104Y probably damaging Het
Olfr146 T A 9: 39,019,379 Y54F probably benign Het
Olfr411 A G 11: 74,346,963 V207A probably benign Het
Olfr881 A T 9: 37,993,085 I198F possibly damaging Het
Otof A G 5: 30,420,974 probably null Het
Pcdhb17 T C 18: 37,486,206 S350P probably damaging Het
Phf3 T C 1: 30,829,946 T674A probably damaging Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Ppfia3 T C 7: 45,352,093 E465G probably damaging Het
Prkg1 T A 19: 31,664,239 I15F probably damaging Het
Rab5c A G 11: 100,720,017 F22L probably damaging Het
Raf1 A G 6: 115,632,919 S220P probably damaging Het
Rgl1 T G 1: 152,521,371 R716S probably damaging Het
Rhbg C A 3: 88,245,966 W205L probably damaging Het
Rimbp3 A G 16: 17,209,189 E159G possibly damaging Het
Ryr1 T C 7: 29,059,831 D3338G probably null Het
Sash1 T C 10: 8,730,385 N747S probably benign Het
Serpina3g A T 12: 104,239,220 I73F probably damaging Het
Sfxn2 C A 19: 46,585,774 N134K probably damaging Het
Slc12a6 A G 2: 112,354,295 H853R probably damaging Het
Slc16a12 C T 19: 34,672,565 D357N probably damaging Het
Slc39a8 T C 3: 135,856,011 Y164H probably benign Het
Snx9 A G 17: 5,927,224 K518E probably damaging Het
Spdye4c G A 2: 128,592,353 V5I possibly damaging Het
Spef2 A G 15: 9,676,373 V704A probably benign Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Strap C A 6: 137,735,386 S11* probably null Het
Tenm2 A G 11: 36,010,487 V2474A probably damaging Het
Tm9sf4 T A 2: 153,187,308 V92D probably damaging Het
Tmf1 A T 6: 97,170,427 M526K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc39d A G 17: 80,217,639 I576V probably benign Het
Upk1a T G 7: 30,605,129 T193P probably benign Het
Vmn2r67 A T 7: 85,150,524 V502E probably benign Het
Wdr17 A G 8: 54,690,048 V189A possibly damaging Het
Wrap73 A T 4: 154,151,696 S161C probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Zfp605 T A 5: 110,127,361 M115K possibly damaging Het
Zp1 T A 19: 10,918,905 H152L probably benign Het
Other mutations in Synpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Synpo2 APN 3 123113210 missense probably damaging 1.00
IGL00742:Synpo2 APN 3 123113876 missense probably damaging 1.00
IGL01890:Synpo2 APN 3 123112497 missense probably damaging 1.00
IGL02268:Synpo2 APN 3 123116983 missense probably damaging 1.00
IGL02323:Synpo2 APN 3 123117534 missense probably benign 0.00
IGL02745:Synpo2 APN 3 123113612 missense probably damaging 1.00
IGL03001:Synpo2 APN 3 123079955 missense probably benign 0.00
IGL03177:Synpo2 APN 3 123121215 missense probably damaging 1.00
IGL03336:Synpo2 APN 3 123114179 missense possibly damaging 0.60
R0086:Synpo2 UTSW 3 123117104 nonsense probably null
R0126:Synpo2 UTSW 3 123079862 missense possibly damaging 0.71
R0227:Synpo2 UTSW 3 123113793 missense probably benign 0.02
R0284:Synpo2 UTSW 3 123079734 nonsense probably null
R0388:Synpo2 UTSW 3 123079897 missense probably benign
R0457:Synpo2 UTSW 3 123112772 missense probably damaging 1.00
R0483:Synpo2 UTSW 3 123114332 missense probably damaging 1.00
R0615:Synpo2 UTSW 3 123117287 missense probably damaging 1.00
R0646:Synpo2 UTSW 3 123114449 missense probably damaging 1.00
R0666:Synpo2 UTSW 3 123114059 missense probably damaging 0.98
R0743:Synpo2 UTSW 3 123112706 missense probably benign 0.02
R0791:Synpo2 UTSW 3 123113186 missense probably benign
R1531:Synpo2 UTSW 3 123117666 missense probably benign 0.03
R1587:Synpo2 UTSW 3 123114398 missense probably damaging 0.98
R1717:Synpo2 UTSW 3 123112554 missense probably damaging 1.00
R1807:Synpo2 UTSW 3 123080257 missense possibly damaging 0.71
R2114:Synpo2 UTSW 3 123079888 missense probably benign 0.01
R2987:Synpo2 UTSW 3 123116973 missense probably damaging 1.00
R3019:Synpo2 UTSW 3 123113579 missense probably damaging 1.00
R3939:Synpo2 UTSW 3 123114590 missense probably damaging 1.00
R4050:Synpo2 UTSW 3 123114278 missense possibly damaging 0.81
R4119:Synpo2 UTSW 3 123117150 missense probably damaging 1.00
R4724:Synpo2 UTSW 3 123114291 missense probably damaging 1.00
R4825:Synpo2 UTSW 3 123114419 missense probably damaging 0.98
R5152:Synpo2 UTSW 3 123235901 critical splice donor site probably null
R5292:Synpo2 UTSW 3 123114060 missense possibly damaging 0.51
R5396:Synpo2 UTSW 3 123117682 nonsense probably null
R5701:Synpo2 UTSW 3 123080230 missense probably damaging 1.00
R5712:Synpo2 UTSW 3 123121210 missense probably damaging 1.00
R5730:Synpo2 UTSW 3 123114119 missense probably benign 0.04
R5879:Synpo2 UTSW 3 123114297 missense probably damaging 1.00
R5979:Synpo2 UTSW 3 123117411 missense probably damaging 1.00
R6290:Synpo2 UTSW 3 123117052 missense probably damaging 0.98
R6384:Synpo2 UTSW 3 123113049 nonsense probably null
R6498:Synpo2 UTSW 3 123080232 synonymous probably null
R7123:Synpo2 UTSW 3 123113186 missense probably benign
R7153:Synpo2 UTSW 3 123112404 makesense probably null
R7233:Synpo2 UTSW 3 123117684 missense probably benign 0.01
R7301:Synpo2 UTSW 3 123114053 missense probably benign 0.10
R7318:Synpo2 UTSW 3 123117319 missense probably benign
R7366:Synpo2 UTSW 3 123114041 missense probably damaging 0.96
R7630:Synpo2 UTSW 3 123080032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATAGCAGCCAGTGGGTAAG -3'
(R):5'- TCAAAATAGCTCAGCCTGCC -3'

Sequencing Primer
(F):5'- CAGCCAGTGGGTAAGAGGGG -3'
(R):5'- AAGCAGTAGTGGTCAGTC -3'
Posted On2015-10-08