Incidental Mutation 'R4669:Raf1'
ID352251
Institutional Source Beutler Lab
Gene Symbol Raf1
Ensembl Gene ENSMUSG00000000441
Gene Namev-raf-leukemia viral oncogene 1
Synonyms6430402F14Rik, Craf1, sarcoma 3611 oncogene, c-Raf, v-Raf, Raf-1
MMRRC Submission 041925-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4669 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115618067-115676635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115632919 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 220 (S220P)
Ref Sequence ENSEMBL: ENSMUSP00000108571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000451] [ENSMUST00000112949]
Predicted Effect probably damaging
Transcript: ENSMUST00000000451
AA Change: S220P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000451
Gene: ENSMUSG00000000441
AA Change: S220P

DomainStartEndE-ValueType
RBD 56 131 6.95e-35 SMART
C1 139 184 1.2e-13 SMART
low complexity region 283 301 N/A INTRINSIC
Pfam:Pkinase 349 606 7.2e-61 PFAM
Pfam:Pkinase_Tyr 349 606 3.5e-65 PFAM
Pfam:Kinase-like 400 596 3.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112949
AA Change: S220P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108571
Gene: ENSMUSG00000000441
AA Change: S220P

DomainStartEndE-ValueType
RBD 56 131 6.95e-35 SMART
C1 139 184 1.2e-13 SMART
low complexity region 283 301 N/A INTRINSIC
Pfam:Pkinase_Tyr 349 606 3.4e-64 PFAM
Pfam:Pkinase 349 608 1.1e-61 PFAM
Pfam:Kinase-like 399 596 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130528
Predicted Effect unknown
Transcript: ENSMUST00000147979
AA Change: S26P
SMART Domains Protein: ENSMUSP00000115424
Gene: ENSMUSG00000000441
AA Change: S26P

DomainStartEndE-ValueType
Blast:RBD 2 28 9e-7 BLAST
PDB:4IHL|P 36 71 1e-9 PDB
low complexity region 110 128 N/A INTRINSIC
PDB:3OMV|B 150 205 6e-33 PDB
SCOP:d1b6cb_ 153 205 3e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are growth retarded, with hypocellular fetal livers, placental anomalies, and defects of skin and lungs, resulting in lethality around mid-gestation. Mice heterozygous for a knock-in allele exhibit hypertrophic cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Acan A G 7: 79,101,142 E464G probably benign Het
Agap1 A G 1: 89,837,806 probably null Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Ap2a1 A T 7: 44,902,919 probably benign Het
Arap3 T C 18: 37,996,254 D217G probably benign Het
Arl2 C A 19: 6,134,686 R179L probably damaging Het
Atg2a T A 19: 6,258,987 probably null Het
B3gat1 T A 9: 26,751,756 L6Q probably benign Het
Bcl10 A G 3: 145,930,572 N75S probably damaging Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Brms1l A G 12: 55,841,571 E48G possibly damaging Het
C2cd2l A T 9: 44,315,025 N414K possibly damaging Het
Capn2 C T 1: 182,470,780 C640Y probably benign Het
Ccdc153 G T 9: 44,245,724 R99M probably damaging Het
Ccdc51 A G 9: 109,090,962 N142S probably benign Het
Ccdc58 A G 16: 36,082,719 D27G probably damaging Het
Cdipt A G 7: 126,978,406 H108R possibly damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Cts3 C T 13: 61,566,823 E223K probably benign Het
Cyp2a22 T C 7: 26,937,855 D168G possibly damaging Het
Cyp2c67 T A 19: 39,643,654 H90L probably benign Het
Ddx4 T C 13: 112,622,244 Y261C probably damaging Het
Dnah17 T C 11: 118,074,293 T2308A probably benign Het
Dnah6 T C 6: 73,037,688 T3587A probably damaging Het
Dpy19l1 C T 9: 24,432,368 V494I possibly damaging Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Emilin3 T C 2: 160,910,797 I78V probably benign Het
Esam T A 9: 37,536,656 Y195* probably null Het
Extl3 T A 14: 65,076,296 N479I possibly damaging Het
Fat2 A G 11: 55,311,615 V211A probably benign Het
Ganc G T 2: 120,431,067 V343F probably benign Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gnmt A T 17: 46,726,299 C186* probably null Het
Gpr75 A T 11: 30,892,072 I326F probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-T23 G T 17: 36,031,798 D149E probably damaging Het
Hmcn2 G T 2: 31,435,792 R4277L probably benign Het
Irf9 C A 14: 55,605,766 H94N probably benign Het
Jhy T C 9: 40,961,153 N20S probably benign Het
Klf17 C A 4: 117,760,371 C263F probably damaging Het
Lama5 T C 2: 180,180,637 Y2881C probably damaging Het
Lig1 T G 7: 13,311,028 I882S probably damaging Het
Ltn1 A T 16: 87,418,487 M420K possibly damaging Het
Mael T C 1: 166,235,508 E125G probably damaging Het
Mib2 C T 4: 155,657,415 D275N possibly damaging Het
Mical3 C T 6: 120,957,703 R1805Q probably damaging Het
Mllt10 A G 2: 18,203,633 D158G probably damaging Het
Mocs1 A G 17: 49,454,585 D569G possibly damaging Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtmr2 T C 9: 13,795,964 S199P probably damaging Het
Ndufaf5 T C 2: 140,187,755 V164A probably benign Het
Nek9 T C 12: 85,314,204 E518G probably benign Het
Nfatc2 T C 2: 168,571,490 I72V probably benign Het
Nlrp9c C T 7: 26,375,368 A746T possibly damaging Het
Nupl2 A G 5: 24,182,417 R402G probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfr1045 A T 2: 86,197,933 M273K possibly damaging Het
Olfr1225 G A 2: 89,170,901 H104Y probably damaging Het
Olfr146 T A 9: 39,019,379 Y54F probably benign Het
Olfr411 A G 11: 74,346,963 V207A probably benign Het
Olfr881 A T 9: 37,993,085 I198F possibly damaging Het
Otof A G 5: 30,420,974 probably null Het
Pcdhb17 T C 18: 37,486,206 S350P probably damaging Het
Phf3 T C 1: 30,829,946 T674A probably damaging Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Ppfia3 T C 7: 45,352,093 E465G probably damaging Het
Prkg1 T A 19: 31,664,239 I15F probably damaging Het
Rab5c A G 11: 100,720,017 F22L probably damaging Het
Rgl1 T G 1: 152,521,371 R716S probably damaging Het
Rhbg C A 3: 88,245,966 W205L probably damaging Het
Rimbp3 A G 16: 17,209,189 E159G possibly damaging Het
Ryr1 T C 7: 29,059,831 D3338G probably null Het
Sash1 T C 10: 8,730,385 N747S probably benign Het
Serpina3g A T 12: 104,239,220 I73F probably damaging Het
Sfxn2 C A 19: 46,585,774 N134K probably damaging Het
Slc12a6 A G 2: 112,354,295 H853R probably damaging Het
Slc16a12 C T 19: 34,672,565 D357N probably damaging Het
Slc39a8 T C 3: 135,856,011 Y164H probably benign Het
Snx9 A G 17: 5,927,224 K518E probably damaging Het
Spdye4c G A 2: 128,592,353 V5I possibly damaging Het
Spef2 A G 15: 9,676,373 V704A probably benign Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Strap C A 6: 137,735,386 S11* probably null Het
Synpo2 A G 3: 123,113,063 L868P probably damaging Het
Tenm2 A G 11: 36,010,487 V2474A probably damaging Het
Tm9sf4 T A 2: 153,187,308 V92D probably damaging Het
Tmf1 A T 6: 97,170,427 M526K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc39d A G 17: 80,217,639 I576V probably benign Het
Upk1a T G 7: 30,605,129 T193P probably benign Het
Vmn2r67 A T 7: 85,150,524 V502E probably benign Het
Wdr17 A G 8: 54,690,048 V189A possibly damaging Het
Wrap73 A T 4: 154,151,696 S161C probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Zfp605 T A 5: 110,127,361 M115K possibly damaging Het
Zp1 T A 19: 10,918,905 H152L probably benign Het
Other mutations in Raf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Raf1 APN 6 115676569 unclassified probably benign
IGL02379:Raf1 APN 6 115644548 missense probably benign
IGL02427:Raf1 APN 6 115631327 missense probably benign
IGL02586:Raf1 APN 6 115620306 missense probably damaging 0.98
IGL02620:Raf1 APN 6 115632887 splice site probably benign
P0028:Raf1 UTSW 6 115631205 splice site probably benign
R0044:Raf1 UTSW 6 115623515 missense probably benign 0.12
R0044:Raf1 UTSW 6 115623515 missense probably benign 0.12
R0116:Raf1 UTSW 6 115626383 missense probably damaging 1.00
R0147:Raf1 UTSW 6 115632973 missense probably benign
R0148:Raf1 UTSW 6 115632973 missense probably benign
R0554:Raf1 UTSW 6 115623530 missense probably benign 0.05
R0811:Raf1 UTSW 6 115626710 critical splice donor site probably null
R0812:Raf1 UTSW 6 115626710 critical splice donor site probably null
R1070:Raf1 UTSW 6 115637699 missense probably benign 0.00
R4261:Raf1 UTSW 6 115623054 critical splice acceptor site probably null
R4846:Raf1 UTSW 6 115644583 missense possibly damaging 0.91
R5038:Raf1 UTSW 6 115620235 nonsense probably null
R5214:Raf1 UTSW 6 115637622 missense possibly damaging 0.82
R5472:Raf1 UTSW 6 115626706 splice site probably null
R5511:Raf1 UTSW 6 115620256 missense probably benign 0.32
R5539:Raf1 UTSW 6 115619356 missense probably damaging 1.00
R5926:Raf1 UTSW 6 115619898 missense probably benign 0.45
R6424:Raf1 UTSW 6 115619581 missense probably benign 0.02
R6649:Raf1 UTSW 6 115631341 missense probably benign 0.03
R7021:Raf1 UTSW 6 115620339 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGTCAAAATCACTTTCCAG -3'
(R):5'- TAGCAGGTGACTAAAGCACTTG -3'

Sequencing Primer
(F):5'- TTCCAGAATATAAGTACGCTGGGACC -3'
(R):5'- GAATCAAGGACAGTTGGGTTTTTGC -3'
Posted On2015-10-08