Incidental Mutation 'R4669:Or8g17'
ID 352277
Institutional Source Beutler Lab
Gene Symbol Or8g17
Ensembl Gene ENSMUSG00000058820
Gene Name olfactory receptor family 8 subfamily G member 17
Synonyms MOR171-10, M15, Olfr146, GA_x6K02T2PVTD-32715386-32714466
MMRRC Submission 041925-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R4669 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38929915-38930835 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38930675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 54 (Y54F)
Ref Sequence ENSEMBL: ENSMUSP00000151064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073671] [ENSMUST00000214369] [ENSMUST00000214410] [ENSMUST00000215383]
AlphaFold Q60884
Predicted Effect probably benign
Transcript: ENSMUST00000073671
AA Change: Y54F

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073352
Gene: ENSMUSG00000058820
AA Change: Y54F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.6e-54 PFAM
Pfam:7tm_1 41 290 8.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214369
AA Change: Y54F

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000214410
AA Change: Y54F

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215383
AA Change: Y54F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Acan A G 7: 78,750,890 (GRCm39) E464G probably benign Het
Agap1 A G 1: 89,765,528 (GRCm39) probably null Het
Akap13 A G 7: 75,378,842 (GRCm39) T2128A probably damaging Het
Ap2a1 A T 7: 44,552,343 (GRCm39) probably benign Het
Arap3 T C 18: 38,129,307 (GRCm39) D217G probably benign Het
Arl2 C A 19: 6,184,716 (GRCm39) R179L probably damaging Het
Atg2a T A 19: 6,309,017 (GRCm39) probably null Het
B3gat1 T A 9: 26,663,052 (GRCm39) L6Q probably benign Het
Bcl10 A G 3: 145,636,327 (GRCm39) N75S probably damaging Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Brms1l A G 12: 55,888,356 (GRCm39) E48G possibly damaging Het
C2cd2l A T 9: 44,226,322 (GRCm39) N414K possibly damaging Het
Capn2 C T 1: 182,298,345 (GRCm39) C640Y probably benign Het
Ccdc153 G T 9: 44,157,021 (GRCm39) R99M probably damaging Het
Ccdc51 A G 9: 108,920,030 (GRCm39) N142S probably benign Het
Cdipt A G 7: 126,577,578 (GRCm39) H108R possibly damaging Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Cts3 C T 13: 61,714,637 (GRCm39) E223K probably benign Het
Cyp2a22 T C 7: 26,637,280 (GRCm39) D168G possibly damaging Het
Cyp2c67 T A 19: 39,632,098 (GRCm39) H90L probably benign Het
Ddx4 T C 13: 112,758,778 (GRCm39) Y261C probably damaging Het
Dnah17 T C 11: 117,965,119 (GRCm39) T2308A probably benign Het
Dnah6 T C 6: 73,014,671 (GRCm39) T3587A probably damaging Het
Dpy19l1 C T 9: 24,343,664 (GRCm39) V494I possibly damaging Het
Dse T G 10: 34,029,008 (GRCm39) Y694S probably damaging Het
Emilin3 T C 2: 160,752,717 (GRCm39) I78V probably benign Het
Esam T A 9: 37,447,952 (GRCm39) Y195* probably null Het
Extl3 T A 14: 65,313,745 (GRCm39) N479I possibly damaging Het
Fat2 A G 11: 55,202,441 (GRCm39) V211A probably benign Het
Ganc G T 2: 120,261,548 (GRCm39) V343F probably benign Het
Ggt5 T C 10: 75,438,865 (GRCm39) L121P probably damaging Het
Gnmt A T 17: 47,037,225 (GRCm39) C186* probably null Het
Gpr75 A T 11: 30,842,072 (GRCm39) I326F probably damaging Het
Gsdme C T 6: 50,185,102 (GRCm39) V451M probably damaging Het
H2-T23 G T 17: 36,342,690 (GRCm39) D149E probably damaging Het
Hmcn2 G T 2: 31,325,804 (GRCm39) R4277L probably benign Het
Irf9 C A 14: 55,843,223 (GRCm39) H94N probably benign Het
Jhy T C 9: 40,872,449 (GRCm39) N20S probably benign Het
Klf17 C A 4: 117,617,568 (GRCm39) C263F probably damaging Het
Lama5 T C 2: 179,822,430 (GRCm39) Y2881C probably damaging Het
Lig1 T G 7: 13,044,953 (GRCm39) I882S probably damaging Het
Ltn1 A T 16: 87,215,375 (GRCm39) M420K possibly damaging Het
Mael T C 1: 166,063,077 (GRCm39) E125G probably damaging Het
Mib2 C T 4: 155,741,872 (GRCm39) D275N possibly damaging Het
Mical3 C T 6: 120,934,664 (GRCm39) R1805Q probably damaging Het
Mix23 A G 16: 35,903,089 (GRCm39) D27G probably damaging Het
Mllt10 A G 2: 18,208,444 (GRCm39) D158G probably damaging Het
Mocs1 A G 17: 49,761,613 (GRCm39) D569G possibly damaging Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Mtmr2 T C 9: 13,707,260 (GRCm39) S199P probably damaging Het
Ndufaf5 T C 2: 140,029,675 (GRCm39) V164A probably benign Het
Nek9 T C 12: 85,360,978 (GRCm39) E518G probably benign Het
Nfatc2 T C 2: 168,413,410 (GRCm39) I72V probably benign Het
Nlrp9c C T 7: 26,074,793 (GRCm39) A746T possibly damaging Het
Nup42 A G 5: 24,387,415 (GRCm39) R402G probably benign Het
Ogdh G T 11: 6,290,600 (GRCm39) C406F probably benign Het
Or3a1d A G 11: 74,237,789 (GRCm39) V207A probably benign Het
Or4c120 G A 2: 89,001,245 (GRCm39) H104Y probably damaging Het
Or8b35 A T 9: 37,904,381 (GRCm39) I198F possibly damaging Het
Or8j3 A T 2: 86,028,277 (GRCm39) M273K possibly damaging Het
Otof A G 5: 30,578,318 (GRCm39) probably null Het
Pcdhb17 T C 18: 37,619,259 (GRCm39) S350P probably damaging Het
Phf3 T C 1: 30,869,027 (GRCm39) T674A probably damaging Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Ppfia3 T C 7: 45,001,517 (GRCm39) E465G probably damaging Het
Prkg1 T A 19: 31,641,639 (GRCm39) I15F probably damaging Het
Rab5c A G 11: 100,610,843 (GRCm39) F22L probably damaging Het
Raf1 A G 6: 115,609,880 (GRCm39) S220P probably damaging Het
Rgl1 T G 1: 152,397,122 (GRCm39) R716S probably damaging Het
Rhbg C A 3: 88,153,273 (GRCm39) W205L probably damaging Het
Rimbp3 A G 16: 17,027,053 (GRCm39) E159G possibly damaging Het
Ryr1 T C 7: 28,759,256 (GRCm39) D3338G probably null Het
Sash1 T C 10: 8,606,149 (GRCm39) N747S probably benign Het
Serpina3g A T 12: 104,205,479 (GRCm39) I73F probably damaging Het
Sfxn2 C A 19: 46,574,213 (GRCm39) N134K probably damaging Het
Slc12a6 A G 2: 112,184,640 (GRCm39) H853R probably damaging Het
Slc16a12 C T 19: 34,649,965 (GRCm39) D357N probably damaging Het
Slc39a8 T C 3: 135,561,772 (GRCm39) Y164H probably benign Het
Snx9 A G 17: 5,977,499 (GRCm39) K518E probably damaging Het
Spdye4c G A 2: 128,434,273 (GRCm39) V5I possibly damaging Het
Spef2 A G 15: 9,676,459 (GRCm39) V704A probably benign Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Strap C A 6: 137,712,384 (GRCm39) S11* probably null Het
Synpo2 A G 3: 122,906,712 (GRCm39) L868P probably damaging Het
Tenm2 A G 11: 35,901,314 (GRCm39) V2474A probably damaging Het
Tm9sf4 T A 2: 153,029,228 (GRCm39) V92D probably damaging Het
Tmf1 A T 6: 97,147,388 (GRCm39) M526K probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttc39d A G 17: 80,525,068 (GRCm39) I576V probably benign Het
Upk1a T G 7: 30,304,554 (GRCm39) T193P probably benign Het
Vmn2r67 A T 7: 84,799,732 (GRCm39) V502E probably benign Het
Wdr17 A G 8: 55,143,083 (GRCm39) V189A possibly damaging Het
Wrap73 A T 4: 154,236,153 (GRCm39) S161C probably benign Het
Zfp568 A G 7: 29,722,702 (GRCm39) H549R probably damaging Het
Zfp605 T A 5: 110,275,227 (GRCm39) M115K possibly damaging Het
Zp1 T A 19: 10,896,269 (GRCm39) H152L probably benign Het
Other mutations in Or8g17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Or8g17 APN 9 38,930,097 (GRCm39) missense probably damaging 0.98
IGL01655:Or8g17 APN 9 38,930,214 (GRCm39) missense probably benign 0.00
IGL01804:Or8g17 APN 9 38,930,697 (GRCm39) missense probably benign 0.13
IGL02098:Or8g17 APN 9 38,930,187 (GRCm39) missense probably damaging 1.00
IGL02719:Or8g17 APN 9 38,930,312 (GRCm39) missense probably benign 0.11
R0531:Or8g17 UTSW 9 38,930,472 (GRCm39) missense probably damaging 0.97
R1270:Or8g17 UTSW 9 38,930,543 (GRCm39) missense possibly damaging 0.90
R1511:Or8g17 UTSW 9 38,930,321 (GRCm39) missense probably benign 0.03
R1590:Or8g17 UTSW 9 38,930,253 (GRCm39) missense probably benign 0.09
R1649:Or8g17 UTSW 9 38,930,776 (GRCm39) missense probably benign 0.03
R3419:Or8g17 UTSW 9 38,930,372 (GRCm39) missense probably benign 0.03
R4788:Or8g17 UTSW 9 38,930,217 (GRCm39) missense probably benign 0.07
R5184:Or8g17 UTSW 9 38,929,998 (GRCm39) missense probably damaging 0.98
R5581:Or8g17 UTSW 9 38,929,998 (GRCm39) missense probably damaging 0.98
R6032:Or8g17 UTSW 9 38,930,261 (GRCm39) missense probably benign 0.00
R6032:Or8g17 UTSW 9 38,930,261 (GRCm39) missense probably benign 0.00
R6319:Or8g17 UTSW 9 38,930,810 (GRCm39) missense probably damaging 1.00
R6626:Or8g17 UTSW 9 38,930,402 (GRCm39) missense possibly damaging 0.63
R6693:Or8g17 UTSW 9 38,930,097 (GRCm39) missense probably damaging 0.98
R7165:Or8g17 UTSW 9 38,934,566 (GRCm39) start gained probably benign
R7947:Or8g17 UTSW 9 38,930,747 (GRCm39) missense probably damaging 0.99
R7957:Or8g17 UTSW 9 38,930,349 (GRCm39) missense probably benign
R8052:Or8g17 UTSW 9 38,930,783 (GRCm39) missense probably damaging 0.99
R8162:Or8g17 UTSW 9 38,930,249 (GRCm39) missense probably benign 0.01
R9004:Or8g17 UTSW 9 38,930,580 (GRCm39) missense probably benign 0.01
R9083:Or8g17 UTSW 9 38,930,016 (GRCm39) missense probably damaging 1.00
R9584:Or8g17 UTSW 9 38,930,462 (GRCm39) missense probably damaging 1.00
Z1088:Or8g17 UTSW 9 38,930,085 (GRCm39) missense probably damaging 1.00
Z1191:Or8g17 UTSW 9 38,930,229 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAACATAGCGATCATATGCC -3'
(R):5'- TCCTTTCAGAATCTGCCTGAG -3'

Sequencing Primer
(F):5'- GCAGCCAGCATGTAACTTTCTG -3'
(R):5'- CCTTTCAGAATCTGCCTGAGAACATG -3'
Posted On 2015-10-08