Incidental Mutation 'R4669:Tenm2'
ID352290
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Nameteneurin transmembrane protein 2
Synonyms2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2
MMRRC Submission 041925-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock #R4669 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location36006656-37235964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36010487 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2474 (V2474A)
Ref Sequence ENSEMBL: ENSMUSP00000129951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
Predicted Effect probably damaging
Transcript: ENSMUST00000057207
AA Change: V2475A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: V2475A

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102801
AA Change: V2474A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: V2474A

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163524
AA Change: V2474A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: V2474A

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Acan A G 7: 79,101,142 E464G probably benign Het
Agap1 A G 1: 89,837,806 probably null Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Ap2a1 A T 7: 44,902,919 probably benign Het
Arap3 T C 18: 37,996,254 D217G probably benign Het
Arl2 C A 19: 6,134,686 R179L probably damaging Het
Atg2a T A 19: 6,258,987 probably null Het
B3gat1 T A 9: 26,751,756 L6Q probably benign Het
Bcl10 A G 3: 145,930,572 N75S probably damaging Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Brms1l A G 12: 55,841,571 E48G possibly damaging Het
C2cd2l A T 9: 44,315,025 N414K possibly damaging Het
Capn2 C T 1: 182,470,780 C640Y probably benign Het
Ccdc153 G T 9: 44,245,724 R99M probably damaging Het
Ccdc51 A G 9: 109,090,962 N142S probably benign Het
Ccdc58 A G 16: 36,082,719 D27G probably damaging Het
Cdipt A G 7: 126,978,406 H108R possibly damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Cts3 C T 13: 61,566,823 E223K probably benign Het
Cyp2a22 T C 7: 26,937,855 D168G possibly damaging Het
Cyp2c67 T A 19: 39,643,654 H90L probably benign Het
Ddx4 T C 13: 112,622,244 Y261C probably damaging Het
Dnah17 T C 11: 118,074,293 T2308A probably benign Het
Dnah6 T C 6: 73,037,688 T3587A probably damaging Het
Dpy19l1 C T 9: 24,432,368 V494I possibly damaging Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Emilin3 T C 2: 160,910,797 I78V probably benign Het
Esam T A 9: 37,536,656 Y195* probably null Het
Extl3 T A 14: 65,076,296 N479I possibly damaging Het
Fat2 A G 11: 55,311,615 V211A probably benign Het
Ganc G T 2: 120,431,067 V343F probably benign Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gnmt A T 17: 46,726,299 C186* probably null Het
Gpr75 A T 11: 30,892,072 I326F probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-T23 G T 17: 36,031,798 D149E probably damaging Het
Hmcn2 G T 2: 31,435,792 R4277L probably benign Het
Irf9 C A 14: 55,605,766 H94N probably benign Het
Jhy T C 9: 40,961,153 N20S probably benign Het
Klf17 C A 4: 117,760,371 C263F probably damaging Het
Lama5 T C 2: 180,180,637 Y2881C probably damaging Het
Lig1 T G 7: 13,311,028 I882S probably damaging Het
Ltn1 A T 16: 87,418,487 M420K possibly damaging Het
Mael T C 1: 166,235,508 E125G probably damaging Het
Mib2 C T 4: 155,657,415 D275N possibly damaging Het
Mical3 C T 6: 120,957,703 R1805Q probably damaging Het
Mllt10 A G 2: 18,203,633 D158G probably damaging Het
Mocs1 A G 17: 49,454,585 D569G possibly damaging Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtmr2 T C 9: 13,795,964 S199P probably damaging Het
Ndufaf5 T C 2: 140,187,755 V164A probably benign Het
Nek9 T C 12: 85,314,204 E518G probably benign Het
Nfatc2 T C 2: 168,571,490 I72V probably benign Het
Nlrp9c C T 7: 26,375,368 A746T possibly damaging Het
Nupl2 A G 5: 24,182,417 R402G probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfr1045 A T 2: 86,197,933 M273K possibly damaging Het
Olfr1225 G A 2: 89,170,901 H104Y probably damaging Het
Olfr146 T A 9: 39,019,379 Y54F probably benign Het
Olfr411 A G 11: 74,346,963 V207A probably benign Het
Olfr881 A T 9: 37,993,085 I198F possibly damaging Het
Otof A G 5: 30,420,974 probably null Het
Pcdhb17 T C 18: 37,486,206 S350P probably damaging Het
Phf3 T C 1: 30,829,946 T674A probably damaging Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Ppfia3 T C 7: 45,352,093 E465G probably damaging Het
Prkg1 T A 19: 31,664,239 I15F probably damaging Het
Rab5c A G 11: 100,720,017 F22L probably damaging Het
Raf1 A G 6: 115,632,919 S220P probably damaging Het
Rgl1 T G 1: 152,521,371 R716S probably damaging Het
Rhbg C A 3: 88,245,966 W205L probably damaging Het
Rimbp3 A G 16: 17,209,189 E159G possibly damaging Het
Ryr1 T C 7: 29,059,831 D3338G probably null Het
Sash1 T C 10: 8,730,385 N747S probably benign Het
Serpina3g A T 12: 104,239,220 I73F probably damaging Het
Sfxn2 C A 19: 46,585,774 N134K probably damaging Het
Slc12a6 A G 2: 112,354,295 H853R probably damaging Het
Slc16a12 C T 19: 34,672,565 D357N probably damaging Het
Slc39a8 T C 3: 135,856,011 Y164H probably benign Het
Snx9 A G 17: 5,927,224 K518E probably damaging Het
Spdye4c G A 2: 128,592,353 V5I possibly damaging Het
Spef2 A G 15: 9,676,373 V704A probably benign Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Strap C A 6: 137,735,386 S11* probably null Het
Synpo2 A G 3: 123,113,063 L868P probably damaging Het
Tm9sf4 T A 2: 153,187,308 V92D probably damaging Het
Tmf1 A T 6: 97,170,427 M526K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc39d A G 17: 80,217,639 I576V probably benign Het
Upk1a T G 7: 30,605,129 T193P probably benign Het
Vmn2r67 A T 7: 85,150,524 V502E probably benign Het
Wdr17 A G 8: 54,690,048 V189A possibly damaging Het
Wrap73 A T 4: 154,151,696 S161C probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Zfp605 T A 5: 110,127,361 M115K possibly damaging Het
Zp1 T A 19: 10,918,905 H152L probably benign Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36206899 splice site probably benign
IGL00834:Tenm2 APN 11 36024258 missense probably damaging 1.00
IGL00911:Tenm2 APN 11 36008733 nonsense probably null
IGL00937:Tenm2 APN 11 36024623 missense probably damaging 1.00
IGL01154:Tenm2 APN 11 36041544 missense probably damaging 1.00
IGL01313:Tenm2 APN 11 36024248 missense probably damaging 0.98
IGL01346:Tenm2 APN 11 36027405 nonsense probably null
IGL01539:Tenm2 APN 11 36106827 missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36864884 missense probably damaging 0.98
IGL01780:Tenm2 APN 11 36046941 missense probably benign
IGL01821:Tenm2 APN 11 36023883 missense probably damaging 0.98
IGL01988:Tenm2 APN 11 36027251 missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36207095 missense probably benign
IGL02449:Tenm2 APN 11 36023622 missense probably damaging 0.99
IGL02505:Tenm2 APN 11 36051916 nonsense probably null
IGL02649:Tenm2 APN 11 36207085 missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 36068458 missense probably benign 0.05
IGL02801:Tenm2 APN 11 36047030 nonsense probably null
IGL02928:Tenm2 APN 11 36027170 missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 36041644 missense probably damaging 1.00
IGL03202:Tenm2 APN 11 36024548 missense probably damaging 1.00
IGL03213:Tenm2 APN 11 36023330 missense probably benign 0.05
IGL03276:Tenm2 APN 11 36072776 missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 36052025 splice site probably null
IGL03381:Tenm2 APN 11 36068411 missense probably benign 0.01
IGL03398:Tenm2 APN 11 36024543 missense probably damaging 1.00
browser UTSW 11 36046765 critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36273408 missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 36063902 missense probably damaging 0.99
R0004:Tenm2 UTSW 11 36023357 missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36207124 splice site probably benign
R0537:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
R0599:Tenm2 UTSW 11 36024780 missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36943976 missense probably damaging 1.00
R0693:Tenm2 UTSW 11 36024809 missense probably damaging 1.00
R0991:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36864684 missense probably benign 0.30
R1177:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 36008358 missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 36041659 missense probably damaging 1.00
R1272:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 36068594 splice site probably benign
R1374:Tenm2 UTSW 11 36008454 missense probably benign 0.00
R1542:Tenm2 UTSW 11 36300220 missense probably damaging 0.99
R1573:Tenm2 UTSW 11 36047069 missense probably damaging 1.00
R1579:Tenm2 UTSW 11 36106783 missense probably damaging 1.00
R1697:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 36008103 missense probably damaging 1.00
R1756:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 36023382 missense probably damaging 0.99
R1950:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 36047547 missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 36047264 nonsense probably null
R2117:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36864862 missense probably damaging 0.98
R2298:Tenm2 UTSW 11 36046777 missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 36027191 missense probably damaging 1.00
R3014:Tenm2 UTSW 11 36023973 missense probably damaging 1.00
R3115:Tenm2 UTSW 11 36023366 missense probably damaging 1.00
R3684:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3685:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3705:Tenm2 UTSW 11 36068326 missense probably damaging 0.97
R3820:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3821:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3822:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3844:Tenm2 UTSW 11 36047538 missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36139574 critical splice donor site probably null
R4019:Tenm2 UTSW 11 36047074 missense probably benign 0.04
R4062:Tenm2 UTSW 11 36008655 missense probably damaging 1.00
R4367:Tenm2 UTSW 11 36027398 missense probably benign
R4395:Tenm2 UTSW 11 36024624 missense probably benign 0.23
R4508:Tenm2 UTSW 11 36008345 missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 36063104 missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 36046780 missense probably damaging 1.00
R4644:Tenm2 UTSW 11 36047136 missense probably benign 0.00
R4661:Tenm2 UTSW 11 36024448 missense probably damaging 0.99
R4687:Tenm2 UTSW 11 36049097 missense probably benign
R4711:Tenm2 UTSW 11 36300212 missense probably damaging 0.98
R4816:Tenm2 UTSW 11 36027290 missense probably damaging 1.00
R4843:Tenm2 UTSW 11 36024020 missense probably damaging 1.00
R4850:Tenm2 UTSW 11 36023488 nonsense probably null
R4870:Tenm2 UTSW 11 36078569 missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36207080 missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5073:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5074:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5081:Tenm2 UTSW 11 36024633 missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36944162 missense probably damaging 1.00
R5170:Tenm2 UTSW 11 36024806 missense probably damaging 0.98
R5253:Tenm2 UTSW 11 36047201 nonsense probably null
R5343:Tenm2 UTSW 11 36069503 missense probably benign 0.00
R5493:Tenm2 UTSW 11 36864676 missense probably benign 0.01
R5600:Tenm2 UTSW 11 36163714 splice site probably null
R5677:Tenm2 UTSW 11 36141683 missense probably damaging 0.98
R5703:Tenm2 UTSW 11 36023799 missense probably benign 0.34
R5707:Tenm2 UTSW 11 36047182 missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 36072729 critical splice donor site probably null
R6063:Tenm2 UTSW 11 36163717 critical splice donor site probably null
R6086:Tenm2 UTSW 11 36008646 missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 36008783 missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36139690 missense probably damaging 0.99
R6193:Tenm2 UTSW 11 36046794 missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36864859 missense probably benign 0.44
R6477:Tenm2 UTSW 11 36010507 critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 36063775 critical splice donor site probably null
R6668:Tenm2 UTSW 11 36046765 critical splice donor site probably null
R6825:Tenm2 UTSW 11 36046884 missense probably benign 0.02
R6885:Tenm2 UTSW 11 36023580 missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36171409 missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36163817 missense probably damaging 0.99
R7153:Tenm2 UTSW 11 36024182 missense probably damaging 0.98
R7173:Tenm2 UTSW 11 36041551 missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36171436 missense probably damaging 1.00
R7205:Tenm2 UTSW 11 36049129 missense probably damaging 0.99
R7250:Tenm2 UTSW 11 36072798 missense probably damaging 1.00
R7290:Tenm2 UTSW 11 36023471 missense probably damaging 1.00
R7366:Tenm2 UTSW 11 36069414 missense probably benign 0.09
R7432:Tenm2 UTSW 11 36864941 missense probably benign
R7504:Tenm2 UTSW 11 36139743 missense probably damaging 1.00
R7513:Tenm2 UTSW 11 36051900 missense probably benign 0.34
R7523:Tenm2 UTSW 11 36078581 splice site probably null
R7527:Tenm2 UTSW 11 36206976 missense probably damaging 1.00
R7648:Tenm2 UTSW 11 36106736 missense probably damaging 1.00
R7653:Tenm2 UTSW 11 36047347 missense probably benign 0.09
R7717:Tenm2 UTSW 11 36864935 missense probably damaging 0.97
R7739:Tenm2 UTSW 11 36069561 missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 36023306 missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 36010449 missense probably damaging 0.99
R7803:Tenm2 UTSW 11 36047116 missense probably damaging 0.98
RF021:Tenm2 UTSW 11 36024203 missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 36024200 missense probably damaging 1.00
X0063:Tenm2 UTSW 11 36024730 missense probably benign
Z1088:Tenm2 UTSW 11 36273267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTTCCTTTCCCAGAAGC -3'
(R):5'- TTTTCAAAGACTCTCTGGTTCCAG -3'

Sequencing Primer
(F):5'- CCCGTGTGGCAGTGTCAATG -3'
(R):5'- AGTTCCCAGAGGCTGTCAC -3'
Posted On2015-10-08