Incidental Mutation 'R4669:Cyp2c67'
ID 352323
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms C730004C24Rik
MMRRC Submission 041925-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R4669 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 39597288-39637497 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39632098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 90 (H90L)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
AlphaFold Q569X9
Predicted Effect probably benign
Transcript: ENSMUST00000067328
AA Change: H90L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: H90L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Acan A G 7: 78,750,890 (GRCm39) E464G probably benign Het
Agap1 A G 1: 89,765,528 (GRCm39) probably null Het
Akap13 A G 7: 75,378,842 (GRCm39) T2128A probably damaging Het
Ap2a1 A T 7: 44,552,343 (GRCm39) probably benign Het
Arap3 T C 18: 38,129,307 (GRCm39) D217G probably benign Het
Arl2 C A 19: 6,184,716 (GRCm39) R179L probably damaging Het
Atg2a T A 19: 6,309,017 (GRCm39) probably null Het
B3gat1 T A 9: 26,663,052 (GRCm39) L6Q probably benign Het
Bcl10 A G 3: 145,636,327 (GRCm39) N75S probably damaging Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Brms1l A G 12: 55,888,356 (GRCm39) E48G possibly damaging Het
C2cd2l A T 9: 44,226,322 (GRCm39) N414K possibly damaging Het
Capn2 C T 1: 182,298,345 (GRCm39) C640Y probably benign Het
Ccdc153 G T 9: 44,157,021 (GRCm39) R99M probably damaging Het
Ccdc51 A G 9: 108,920,030 (GRCm39) N142S probably benign Het
Cdipt A G 7: 126,577,578 (GRCm39) H108R possibly damaging Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Cts3 C T 13: 61,714,637 (GRCm39) E223K probably benign Het
Cyp2a22 T C 7: 26,637,280 (GRCm39) D168G possibly damaging Het
Ddx4 T C 13: 112,758,778 (GRCm39) Y261C probably damaging Het
Dnah17 T C 11: 117,965,119 (GRCm39) T2308A probably benign Het
Dnah6 T C 6: 73,014,671 (GRCm39) T3587A probably damaging Het
Dpy19l1 C T 9: 24,343,664 (GRCm39) V494I possibly damaging Het
Dse T G 10: 34,029,008 (GRCm39) Y694S probably damaging Het
Emilin3 T C 2: 160,752,717 (GRCm39) I78V probably benign Het
Esam T A 9: 37,447,952 (GRCm39) Y195* probably null Het
Extl3 T A 14: 65,313,745 (GRCm39) N479I possibly damaging Het
Fat2 A G 11: 55,202,441 (GRCm39) V211A probably benign Het
Ganc G T 2: 120,261,548 (GRCm39) V343F probably benign Het
Ggt5 T C 10: 75,438,865 (GRCm39) L121P probably damaging Het
Gnmt A T 17: 47,037,225 (GRCm39) C186* probably null Het
Gpr75 A T 11: 30,842,072 (GRCm39) I326F probably damaging Het
Gsdme C T 6: 50,185,102 (GRCm39) V451M probably damaging Het
H2-T23 G T 17: 36,342,690 (GRCm39) D149E probably damaging Het
Hmcn2 G T 2: 31,325,804 (GRCm39) R4277L probably benign Het
Irf9 C A 14: 55,843,223 (GRCm39) H94N probably benign Het
Jhy T C 9: 40,872,449 (GRCm39) N20S probably benign Het
Klf17 C A 4: 117,617,568 (GRCm39) C263F probably damaging Het
Lama5 T C 2: 179,822,430 (GRCm39) Y2881C probably damaging Het
Lig1 T G 7: 13,044,953 (GRCm39) I882S probably damaging Het
Ltn1 A T 16: 87,215,375 (GRCm39) M420K possibly damaging Het
Mael T C 1: 166,063,077 (GRCm39) E125G probably damaging Het
Mib2 C T 4: 155,741,872 (GRCm39) D275N possibly damaging Het
Mical3 C T 6: 120,934,664 (GRCm39) R1805Q probably damaging Het
Mix23 A G 16: 35,903,089 (GRCm39) D27G probably damaging Het
Mllt10 A G 2: 18,208,444 (GRCm39) D158G probably damaging Het
Mocs1 A G 17: 49,761,613 (GRCm39) D569G possibly damaging Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Mtmr2 T C 9: 13,707,260 (GRCm39) S199P probably damaging Het
Ndufaf5 T C 2: 140,029,675 (GRCm39) V164A probably benign Het
Nek9 T C 12: 85,360,978 (GRCm39) E518G probably benign Het
Nfatc2 T C 2: 168,413,410 (GRCm39) I72V probably benign Het
Nlrp9c C T 7: 26,074,793 (GRCm39) A746T possibly damaging Het
Nup42 A G 5: 24,387,415 (GRCm39) R402G probably benign Het
Ogdh G T 11: 6,290,600 (GRCm39) C406F probably benign Het
Or3a1d A G 11: 74,237,789 (GRCm39) V207A probably benign Het
Or4c120 G A 2: 89,001,245 (GRCm39) H104Y probably damaging Het
Or8b35 A T 9: 37,904,381 (GRCm39) I198F possibly damaging Het
Or8g17 T A 9: 38,930,675 (GRCm39) Y54F probably benign Het
Or8j3 A T 2: 86,028,277 (GRCm39) M273K possibly damaging Het
Otof A G 5: 30,578,318 (GRCm39) probably null Het
Pcdhb17 T C 18: 37,619,259 (GRCm39) S350P probably damaging Het
Phf3 T C 1: 30,869,027 (GRCm39) T674A probably damaging Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Ppfia3 T C 7: 45,001,517 (GRCm39) E465G probably damaging Het
Prkg1 T A 19: 31,641,639 (GRCm39) I15F probably damaging Het
Rab5c A G 11: 100,610,843 (GRCm39) F22L probably damaging Het
Raf1 A G 6: 115,609,880 (GRCm39) S220P probably damaging Het
Rgl1 T G 1: 152,397,122 (GRCm39) R716S probably damaging Het
Rhbg C A 3: 88,153,273 (GRCm39) W205L probably damaging Het
Rimbp3 A G 16: 17,027,053 (GRCm39) E159G possibly damaging Het
Ryr1 T C 7: 28,759,256 (GRCm39) D3338G probably null Het
Sash1 T C 10: 8,606,149 (GRCm39) N747S probably benign Het
Serpina3g A T 12: 104,205,479 (GRCm39) I73F probably damaging Het
Sfxn2 C A 19: 46,574,213 (GRCm39) N134K probably damaging Het
Slc12a6 A G 2: 112,184,640 (GRCm39) H853R probably damaging Het
Slc16a12 C T 19: 34,649,965 (GRCm39) D357N probably damaging Het
Slc39a8 T C 3: 135,561,772 (GRCm39) Y164H probably benign Het
Snx9 A G 17: 5,977,499 (GRCm39) K518E probably damaging Het
Spdye4c G A 2: 128,434,273 (GRCm39) V5I possibly damaging Het
Spef2 A G 15: 9,676,459 (GRCm39) V704A probably benign Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Strap C A 6: 137,712,384 (GRCm39) S11* probably null Het
Synpo2 A G 3: 122,906,712 (GRCm39) L868P probably damaging Het
Tenm2 A G 11: 35,901,314 (GRCm39) V2474A probably damaging Het
Tm9sf4 T A 2: 153,029,228 (GRCm39) V92D probably damaging Het
Tmf1 A T 6: 97,147,388 (GRCm39) M526K probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttc39d A G 17: 80,525,068 (GRCm39) I576V probably benign Het
Upk1a T G 7: 30,304,554 (GRCm39) T193P probably benign Het
Vmn2r67 A T 7: 84,799,732 (GRCm39) V502E probably benign Het
Wdr17 A G 8: 55,143,083 (GRCm39) V189A possibly damaging Het
Wrap73 A T 4: 154,236,153 (GRCm39) S161C probably benign Het
Zfp568 A G 7: 29,722,702 (GRCm39) H549R probably damaging Het
Zfp605 T A 5: 110,275,227 (GRCm39) M115K possibly damaging Het
Zp1 T A 19: 10,896,269 (GRCm39) H152L probably benign Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39,631,829 (GRCm39) missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39,628,376 (GRCm39) nonsense probably null
IGL01363:Cyp2c67 APN 19 39,628,411 (GRCm39) missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39,604,165 (GRCm39) missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39,637,470 (GRCm39) missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39,637,446 (GRCm39) missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39,605,861 (GRCm39) missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39,605,826 (GRCm39) nonsense probably null
IGL02355:Cyp2c67 APN 19 39,631,849 (GRCm39) missense probably benign 0.34
IGL02358:Cyp2c67 APN 19 39,605,861 (GRCm39) missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39,605,826 (GRCm39) nonsense probably null
IGL02362:Cyp2c67 APN 19 39,631,849 (GRCm39) missense probably benign 0.34
IGL02388:Cyp2c67 APN 19 39,631,799 (GRCm39) missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39,632,119 (GRCm39) missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39,631,738 (GRCm39) missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39,631,713 (GRCm39) critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39,632,128 (GRCm39) missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39,628,405 (GRCm39) missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39,637,329 (GRCm39) missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39,627,138 (GRCm39) missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39,597,622 (GRCm39) missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39,631,818 (GRCm39) missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39,614,585 (GRCm39) missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39,627,069 (GRCm39) missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39,627,035 (GRCm39) missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39,637,408 (GRCm39) missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39,631,708 (GRCm39) splice site probably benign
R1613:Cyp2c67 UTSW 19 39,614,643 (GRCm39) missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39,631,708 (GRCm39) splice site probably benign
R1667:Cyp2c67 UTSW 19 39,632,034 (GRCm39) critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39,605,811 (GRCm39) missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39,631,789 (GRCm39) missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39,614,681 (GRCm39) missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39,597,541 (GRCm39) missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39,627,127 (GRCm39) missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39,627,032 (GRCm39) missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39,632,188 (GRCm39) missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39,604,168 (GRCm39) missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39,627,132 (GRCm39) missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39,614,676 (GRCm39) missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39,604,094 (GRCm39) missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39,604,138 (GRCm39) missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39,605,879 (GRCm39) missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39,605,873 (GRCm39) missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39,605,854 (GRCm39) nonsense probably null
R6939:Cyp2c67 UTSW 19 39,631,778 (GRCm39) missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39,604,123 (GRCm39) missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39,628,341 (GRCm39) missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39,604,138 (GRCm39) missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39,605,783 (GRCm39) missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39,628,451 (GRCm39) nonsense probably null
R7337:Cyp2c67 UTSW 19 39,597,708 (GRCm39) splice site probably null
R7474:Cyp2c67 UTSW 19 39,605,876 (GRCm39) missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39,604,084 (GRCm39) missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39,597,669 (GRCm39) missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39,628,452 (GRCm39) missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39,627,118 (GRCm39) missense probably benign 0.01
R8717:Cyp2c67 UTSW 19 39,627,155 (GRCm39) missense probably benign 0.05
R8728:Cyp2c67 UTSW 19 39,614,605 (GRCm39) missense probably damaging 1.00
R9275:Cyp2c67 UTSW 19 39,597,699 (GRCm39) missense probably damaging 1.00
R9278:Cyp2c67 UTSW 19 39,597,699 (GRCm39) missense probably damaging 1.00
R9376:Cyp2c67 UTSW 19 39,627,178 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c67 UTSW 19 39,632,123 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATAGAGCCCAAACCTATGCCTG -3'
(R):5'- TGTCAACAGCCTGAAAGATTTTCTG -3'

Sequencing Primer
(F):5'- TGCCTGACAAGCAAGCATG -3'
(R):5'- CTGGCATACTGTAAACCATGAATAC -3'
Posted On 2015-10-08