Incidental Mutation 'R4655:Pus10'
ID352370
Institutional Source Beutler Lab
Gene Symbol Pus10
Ensembl Gene ENSMUSG00000020280
Gene Namepseudouridylate synthase 10
SynonymsCcdc139, 4933435A13Rik, 2810013G11Rik
MMRRC Submission 041915-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4655 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23665674-23732876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23672707 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 109 (V109A)
Ref Sequence ENSEMBL: ENSMUSP00000117934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020520] [ENSMUST00000058163] [ENSMUST00000109525] [ENSMUST00000143117]
Predicted Effect probably benign
Transcript: ENSMUST00000020520
AA Change: V109A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020520
Gene: ENSMUSG00000020280
AA Change: V109A

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000058163
AA Change: V109A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000050395
Gene: ENSMUSG00000020280
AA Change: V109A

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109525
AA Change: V109A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105151
Gene: ENSMUSG00000020280
AA Change: V109A

DomainStartEndE-ValueType
PDB:2V9K|A 1 527 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136365
Predicted Effect probably benign
Transcript: ENSMUST00000143117
AA Change: V109A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117934
Gene: ENSMUSG00000020280
AA Change: V109A

DomainStartEndE-ValueType
PDB:2V9K|A 1 140 4e-65 PDB
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pseudouridination, the isomerization of uridine to pseudouridine, is the most common posttranscriptional nucleotide modification found in RNA and is essential for biologic functions such as spliceosome biogenesis. Pseudouridylate synthases, such as PUS10, catalyze pseudouridination of structural RNAs, including transfer, ribosomal, and splicing RNAs. These enzymes also act as RNA chaperones, facilitating the correct folding and assembly of tRNAs (McCleverty et al., 2007 [PubMed 17900615]).[supplied by OMIM, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,858 V300A probably benign Het
Abca4 A G 3: 122,147,498 N405S possibly damaging Het
Acsl3 A G 1: 78,690,346 T212A probably damaging Het
Ahnak A G 19: 9,008,701 K2450E probably damaging Het
Akap9 G A 5: 4,046,403 R2426H probably benign Het
Akr1c6 T C 13: 4,449,429 V266A probably damaging Het
Ccs A G 19: 4,839,204 V11A probably benign Het
Cdc14a T A 3: 116,328,487 H228L probably damaging Het
Cgn G A 3: 94,779,249 Q248* probably null Het
Cux2 G A 5: 121,885,934 T92M possibly damaging Het
Cyb5r4 A G 9: 87,059,429 K68E probably benign Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dnah9 T C 11: 65,955,732 N2918S probably benign Het
Dyrk1b T C 7: 28,185,751 V438A probably damaging Het
Eml1 G A 12: 108,534,713 D625N probably damaging Het
Eno2 T C 6: 124,763,926 probably null Het
Ephb3 G A 16: 21,222,208 G672D probably damaging Het
Evx1 A T 6: 52,314,197 D118V probably damaging Het
Fbxl13 A G 5: 21,582,039 L300S probably damaging Het
Fbxo30 T C 10: 11,291,093 F520L probably damaging Het
Flt3 G A 5: 147,349,593 P728S possibly damaging Het
Gas2l2 T C 11: 83,423,175 E437G possibly damaging Het
Gldc A T 19: 30,160,702 probably benign Het
Gm10334 T A 6: 41,446,050 I6F probably benign Het
Gm13124 A T 4: 144,555,075 F382L probably benign Het
Gm18856 T C 13: 13,965,647 probably benign Het
Gm7358 A T 17: 14,059,148 noncoding transcript Het
Grifin A G 5: 140,564,545 V47A possibly damaging Het
Hddc2 G T 10: 31,328,020 probably benign Het
Hist1h3f T C 13: 23,544,753 V90A probably benign Het
Hkdc1 T A 10: 62,400,463 R433S probably benign Het
Htt A G 5: 34,906,132 D2918G probably benign Het
Itga2 A C 13: 114,873,269 D383E probably benign Het
Itpr1 G A 6: 108,481,293 C2007Y probably damaging Het
Krt42 C A 11: 100,269,845 Q9H probably damaging Het
Lyrm7 T C 11: 54,848,608 Q72R probably damaging Het
Mmp9 A G 2: 164,951,202 S424G probably benign Het
Mtr A G 13: 12,227,793 V457A probably damaging Het
Myo15b T C 11: 115,890,697 L1359P probably damaging Het
Neb A G 2: 52,227,299 L4087P probably damaging Het
Npl T C 1: 153,515,406 D201G probably damaging Het
Olfr1047 A G 2: 86,228,693 S93P probably benign Het
Olfr366 A G 2: 37,219,873 N128S probably benign Het
Olfr905 C A 9: 38,472,824 P26T probably damaging Het
Pclo T C 5: 14,682,383 probably benign Het
Pdp2 A G 8: 104,594,536 D339G probably benign Het
Pfdn6 A T 17: 33,940,040 Y16* probably null Het
Pilra C T 5: 137,835,326 probably null Het
Prrc2a A T 17: 35,155,614 N1353K probably benign Het
Ptger4 C A 15: 5,243,064 A50S probably benign Het
Pus3 A C 9: 35,564,932 D39A probably benign Het
Rab44 A G 17: 29,139,194 N119D probably benign Het
Rasgrp2 T C 19: 6,404,846 probably benign Het
Rhobtb2 T A 14: 69,795,989 I511F probably damaging Het
Sfxn1 C A 13: 54,092,438 A167D probably benign Het
Slc12a6 A G 2: 112,357,766 probably null Het
Smyd4 C T 11: 75,390,732 L344F probably damaging Het
Srsf11 A G 3: 158,023,335 V93A probably benign Het
Tle1 A G 4: 72,145,344 I224T possibly damaging Het
Tmc6 A T 11: 117,773,042 S479R possibly damaging Het
Tmprss4 T C 9: 45,176,404 M296V probably benign Het
Togaram1 A G 12: 64,967,120 N382D possibly damaging Het
Tpcn1 A G 5: 120,539,257 S662P probably damaging Het
Tppp G T 13: 74,030,864 R141S probably benign Het
Ttc21a A G 9: 119,961,762 D858G possibly damaging Het
Tuba3a A G 6: 125,281,167 S287P possibly damaging Het
Unc80 T G 1: 66,671,662 S2697A probably benign Het
Vmn1r69 A G 7: 10,580,099 V235A probably benign Het
Vmn2r26 T A 6: 124,061,416 I650N probably damaging Het
Vmn2r53 G A 7: 12,582,005 T629I possibly damaging Het
Vmn2r74 T C 7: 85,961,347 T46A probably benign Het
Vmn2r84 A T 10: 130,394,104 C46* probably null Het
Vps13b T C 15: 35,770,689 S2093P probably benign Het
Wdfy4 T C 14: 32,989,936 R2375G probably damaging Het
Wnk2 T G 13: 49,056,883 E1820A probably damaging Het
Other mutations in Pus10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pus10 APN 11 23707548 nonsense probably null
IGL02304:Pus10 APN 11 23712275 missense probably damaging 1.00
IGL02466:Pus10 APN 11 23725574 missense probably damaging 0.99
IGL02967:Pus10 APN 11 23718602 missense probably damaging 1.00
IGL03233:Pus10 APN 11 23712241 missense probably damaging 1.00
IGL03300:Pus10 APN 11 23731368 utr 3 prime probably benign
PIT4486001:Pus10 UTSW 11 23712326 critical splice donor site probably null
PIT4677001:Pus10 UTSW 11 23720171 missense possibly damaging 0.88
R0166:Pus10 UTSW 11 23667358 missense probably damaging 1.00
R0440:Pus10 UTSW 11 23673331 unclassified probably benign
R0519:Pus10 UTSW 11 23711201 missense probably benign 0.02
R1583:Pus10 UTSW 11 23673239 missense probably damaging 0.96
R1714:Pus10 UTSW 11 23725542 missense probably damaging 1.00
R1941:Pus10 UTSW 11 23711198 missense possibly damaging 0.60
R3687:Pus10 UTSW 11 23667334 missense probably benign
R3688:Pus10 UTSW 11 23667334 missense probably benign
R3854:Pus10 UTSW 11 23703003 critical splice donor site probably null
R4064:Pus10 UTSW 11 23728983 missense probably damaging 1.00
R4127:Pus10 UTSW 11 23718654 critical splice donor site probably null
R4276:Pus10 UTSW 11 23706895 missense probably damaging 1.00
R5302:Pus10 UTSW 11 23667416 critical splice donor site probably null
R5580:Pus10 UTSW 11 23672556 missense probably benign 0.16
R6196:Pus10 UTSW 11 23672638 missense probably benign 0.15
R6549:Pus10 UTSW 11 23729075 critical splice donor site probably null
R6722:Pus10 UTSW 11 23702975 missense possibly damaging 0.93
R6724:Pus10 UTSW 11 23729037 missense possibly damaging 0.78
X0064:Pus10 UTSW 11 23708743 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGCCCTCAATGACACTTTAAAATG -3'
(R):5'- AGTGACCACCTGGAATAAAGC -3'

Sequencing Primer
(F):5'- GAGCTACAAAAATTTCTAGAACCGG -3'
(R):5'- CCACCTGGAATAAAGCAAGCAGG -3'
Posted On2015-10-08