Incidental Mutation 'R4655:Wdfy4'
ID352388
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene NameWD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission 041915-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4655 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32959547-33185508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32989936 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 2375 (R2375G)
Ref Sequence ENSEMBL: ENSMUSP00000057556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038956] [ENSMUST00000061753] [ENSMUST00000120588] [ENSMUST00000120866] [ENSMUST00000120951] [ENSMUST00000123822] [ENSMUST00000130509]
Predicted Effect probably benign
Transcript: ENSMUST00000038956
SMART Domains Protein: ENSMUSP00000041199
Gene: ENSMUSG00000041673

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
LRR 49 71 3.27e1 SMART
LRR 72 95 1.31e0 SMART
Pfam:LRR_7 96 114 3.5e-2 PFAM
LRR 120 142 1.26e2 SMART
LRR 143 166 1.49e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000061753
AA Change: R2375G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: R2375G

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120588
SMART Domains Protein: ENSMUSP00000113825
Gene: ENSMUSG00000041673

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120866
SMART Domains Protein: ENSMUSP00000113608
Gene: ENSMUSG00000041673

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
LRR 49 71 3.27e1 SMART
LRR 72 95 1.31e0 SMART
Pfam:LRR_7 96 114 5.3e-2 PFAM
LRR 120 142 1.26e2 SMART
LRR 143 166 1.49e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120951
SMART Domains Protein: ENSMUSP00000113965
Gene: ENSMUSG00000041673

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
LRR 49 71 3.27e1 SMART
LRR 72 95 1.31e0 SMART
LRR 120 142 1.26e2 SMART
LRR 143 166 1.49e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123822
SMART Domains Protein: ENSMUSP00000123178
Gene: ENSMUSG00000041673

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
LRR 49 71 3.27e1 SMART
LRR 72 95 1.31e0 SMART
Pfam:LRR_7 96 110 4.6e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130509
AA Change: R2534G

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: R2534G

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Meta Mutation Damage Score 0.3055 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (79/82)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,858 V300A probably benign Het
Abca4 A G 3: 122,147,498 N405S possibly damaging Het
Acsl3 A G 1: 78,690,346 T212A probably damaging Het
Ahnak A G 19: 9,008,701 K2450E probably damaging Het
Akap9 G A 5: 4,046,403 R2426H probably benign Het
Akr1c6 T C 13: 4,449,429 V266A probably damaging Het
Ccs A G 19: 4,839,204 V11A probably benign Het
Cdc14a T A 3: 116,328,487 H228L probably damaging Het
Cgn G A 3: 94,779,249 Q248* probably null Het
Cux2 G A 5: 121,885,934 T92M possibly damaging Het
Cyb5r4 A G 9: 87,059,429 K68E probably benign Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dnah9 T C 11: 65,955,732 N2918S probably benign Het
Dyrk1b T C 7: 28,185,751 V438A probably damaging Het
Eml1 G A 12: 108,534,713 D625N probably damaging Het
Eno2 T C 6: 124,763,926 probably null Het
Ephb3 G A 16: 21,222,208 G672D probably damaging Het
Evx1 A T 6: 52,314,197 D118V probably damaging Het
Fbxl13 A G 5: 21,582,039 L300S probably damaging Het
Fbxo30 T C 10: 11,291,093 F520L probably damaging Het
Flt3 G A 5: 147,349,593 P728S possibly damaging Het
Gas2l2 T C 11: 83,423,175 E437G possibly damaging Het
Gldc A T 19: 30,160,702 probably benign Het
Gm10334 T A 6: 41,446,050 I6F probably benign Het
Gm13124 A T 4: 144,555,075 F382L probably benign Het
Gm18856 T C 13: 13,965,647 probably benign Het
Gm7358 A T 17: 14,059,148 noncoding transcript Het
Grifin A G 5: 140,564,545 V47A possibly damaging Het
Hddc2 G T 10: 31,328,020 probably benign Het
Hist1h3f T C 13: 23,544,753 V90A probably benign Het
Hkdc1 T A 10: 62,400,463 R433S probably benign Het
Htt A G 5: 34,906,132 D2918G probably benign Het
Itga2 A C 13: 114,873,269 D383E probably benign Het
Itpr1 G A 6: 108,481,293 C2007Y probably damaging Het
Krt42 C A 11: 100,269,845 Q9H probably damaging Het
Lyrm7 T C 11: 54,848,608 Q72R probably damaging Het
Mmp9 A G 2: 164,951,202 S424G probably benign Het
Mtr A G 13: 12,227,793 V457A probably damaging Het
Myo15b T C 11: 115,890,697 L1359P probably damaging Het
Neb A G 2: 52,227,299 L4087P probably damaging Het
Npl T C 1: 153,515,406 D201G probably damaging Het
Olfr1047 A G 2: 86,228,693 S93P probably benign Het
Olfr366 A G 2: 37,219,873 N128S probably benign Het
Olfr905 C A 9: 38,472,824 P26T probably damaging Het
Pclo T C 5: 14,682,383 probably benign Het
Pdp2 A G 8: 104,594,536 D339G probably benign Het
Pfdn6 A T 17: 33,940,040 Y16* probably null Het
Pilra C T 5: 137,835,326 probably null Het
Prrc2a A T 17: 35,155,614 N1353K probably benign Het
Ptger4 C A 15: 5,243,064 A50S probably benign Het
Pus10 T C 11: 23,672,707 V109A probably benign Het
Pus3 A C 9: 35,564,932 D39A probably benign Het
Rab44 A G 17: 29,139,194 N119D probably benign Het
Rasgrp2 T C 19: 6,404,846 probably benign Het
Rhobtb2 T A 14: 69,795,989 I511F probably damaging Het
Sfxn1 C A 13: 54,092,438 A167D probably benign Het
Slc12a6 A G 2: 112,357,766 probably null Het
Smyd4 C T 11: 75,390,732 L344F probably damaging Het
Srsf11 A G 3: 158,023,335 V93A probably benign Het
Tle1 A G 4: 72,145,344 I224T possibly damaging Het
Tmc6 A T 11: 117,773,042 S479R possibly damaging Het
Tmprss4 T C 9: 45,176,404 M296V probably benign Het
Togaram1 A G 12: 64,967,120 N382D possibly damaging Het
Tpcn1 A G 5: 120,539,257 S662P probably damaging Het
Tppp G T 13: 74,030,864 R141S probably benign Het
Ttc21a A G 9: 119,961,762 D858G possibly damaging Het
Tuba3a A G 6: 125,281,167 S287P possibly damaging Het
Unc80 T G 1: 66,671,662 S2697A probably benign Het
Vmn1r69 A G 7: 10,580,099 V235A probably benign Het
Vmn2r26 T A 6: 124,061,416 I650N probably damaging Het
Vmn2r53 G A 7: 12,582,005 T629I possibly damaging Het
Vmn2r74 T C 7: 85,961,347 T46A probably benign Het
Vmn2r84 A T 10: 130,394,104 C46* probably null Het
Vps13b T C 15: 35,770,689 S2093P probably benign Het
Wnk2 T G 13: 49,056,883 E1820A probably damaging Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 33102539 missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32959977 missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 33104037 missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 33151661 missense probably benign 0.01
IGL01700:Wdfy4 APN 14 33020238 splice site probably benign
IGL01931:Wdfy4 APN 14 33155753 missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 33133716 missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 33076480 missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 33093300 missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 33149566 missense probably benign
IGL02468:Wdfy4 APN 14 32966432 missense probably benign 0.01
IGL02512:Wdfy4 APN 14 33042491 missense probably benign 0.01
IGL02597:Wdfy4 APN 14 33090861 nonsense probably null
IGL02752:Wdfy4 APN 14 33076326 missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 33095305 missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32971750 missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 33109650 missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 33076284 missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 33140651 missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32966435 missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 33162870 missense probably benign 0.01
IGL03198:Wdfy4 APN 14 33125887 missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32977167 missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 33068904 missense probably benign 0.01
IGL03398:Wdfy4 APN 14 33047290 missense probably benign 0.14
Dollar UTSW 14 33020311 missense probably damaging 1.00
Giants UTSW 14 33070618 nonsense probably null
kings_canyon UTSW 14 33109519 nonsense probably null
moro UTSW 14 32964626 splice site probably null
sequoia UTSW 14 33100903 critical splice donor site probably null
Sherman UTSW 14 33095951 missense possibly damaging 0.89
watchtower UTSW 14 33083639 critical splice donor site probably null
R0014:Wdfy4 UTSW 14 33107173 missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 33162751 missense probably null 1.00
R0085:Wdfy4 UTSW 14 33078243 missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 33083785 missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 33083812 splice site probably benign
R0496:Wdfy4 UTSW 14 33140738 splice site probably benign
R0514:Wdfy4 UTSW 14 33080775 missense probably benign 0.22
R0548:Wdfy4 UTSW 14 33042621 missense probably benign
R0590:Wdfy4 UTSW 14 33041174 missense probably benign 0.09
R0647:Wdfy4 UTSW 14 33109699 missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 33140612 missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 33147092 missense probably benign 0.03
R1024:Wdfy4 UTSW 14 33079966 missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32971738 missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32971772 splice site probably null
R1415:Wdfy4 UTSW 14 33041180 missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 33108688 missense probably benign 0.14
R1483:Wdfy4 UTSW 14 33100966 missense probably benign 0.41
R1490:Wdfy4 UTSW 14 33152538 critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32960808 missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32959961 missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 33073585 critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 33096005 missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 33103983 missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 33133344 missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32971684 missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 33106044 missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 33146989 missense probably benign 0.11
R2241:Wdfy4 UTSW 14 33073511 missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 33162807 missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 33109519 nonsense probably null
R2889:Wdfy4 UTSW 14 33109519 nonsense probably null
R3114:Wdfy4 UTSW 14 33089903 missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3758:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3797:Wdfy4 UTSW 14 33140645 missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32966395 missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 33102680 splice site probably benign
R4091:Wdfy4 UTSW 14 33125880 missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 33096083 missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 33087955 missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4689:Wdfy4 UTSW 14 33109548 missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 33145316 missense probably benign 0.03
R4862:Wdfy4 UTSW 14 33100903 critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32988895 nonsense probably null
R4894:Wdfy4 UTSW 14 33155760 missense probably benign 0.03
R4929:Wdfy4 UTSW 14 33047256 missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 33029013 missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 33100940 missense probably benign 0.02
R5020:Wdfy4 UTSW 14 33079935 missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 33152670 missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 33047275 missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 33078343 missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 33090866 missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32988899 missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32960002 missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 33020311 missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 33151732 missense probably benign 0.17
R5591:Wdfy4 UTSW 14 33107130 missense probably benign 0.09
R5598:Wdfy4 UTSW 14 33133497 missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 33107618 splice site probably null
R5890:Wdfy4 UTSW 14 33102577 missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 33133360 missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 33106011 missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 33083639 critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32971711 missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 33109525 missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 33101049 nonsense probably null
R6370:Wdfy4 UTSW 14 33068850 missense probably benign 0.16
R6390:Wdfy4 UTSW 14 33104094 missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32967647 missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 33108692 missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 33146944 missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 33047251 missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 33095951 missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32959966 missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 33099117 missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32964626 splice site probably null
R7101:Wdfy4 UTSW 14 32960820 missense
R7114:Wdfy4 UTSW 14 32971574 splice site probably null
R7139:Wdfy4 UTSW 14 33151578 missense
R7255:Wdfy4 UTSW 14 32974282 missense
R7324:Wdfy4 UTSW 14 33047314 missense
R7379:Wdfy4 UTSW 14 33151609 missense
R7399:Wdfy4 UTSW 14 33068906 missense
R7408:Wdfy4 UTSW 14 33078307 missense
R7410:Wdfy4 UTSW 14 32974234 missense
R7411:Wdfy4 UTSW 14 33106131 missense
R7412:Wdfy4 UTSW 14 33149584 missense
R7445:Wdfy4 UTSW 14 33070618 nonsense probably null
R7595:Wdfy4 UTSW 14 32974154 critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32985739 missense
R7622:Wdfy4 UTSW 14 33078274 missense
R7828:Wdfy4 UTSW 14 32988921 missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 33090963 missense
R7971:Wdfy4 UTSW 14 33090963 missense
R8001:Wdfy4 UTSW 14 32973535 critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32971627 missense
R8015:Wdfy4 UTSW 14 33107747 missense
R8032:Wdfy4 UTSW 14 33029086 nonsense probably null
R8041:Wdfy4 UTSW 14 33154008 critical splice donor site probably null
X0028:Wdfy4 UTSW 14 33080636 missense probably benign
X0053:Wdfy4 UTSW 14 33162942 start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 33107618 splice site probably null
Z1177:Wdfy4 UTSW 14 33087985 missense
Predicted Primers PCR Primer
(F):5'- TTCTCTGGGTCATCGTCAAAGAC -3'
(R):5'- GTCTGTGCTGACCTCTGAAAAC -3'

Sequencing Primer
(F):5'- CATCCTGAGATCTTGTCAGAGACAG -3'
(R):5'- GCTGACCTCTGAAAACTGTCAAATG -3'
Posted On2015-10-08