Mutagenetix > Incidental Mutations

Incidental Mutation 'R4655:Wdfy4'

352388

Institutional Source

Beutler Lab

Gene Symbol

Wdfy4

Ensembl Gene

ENSMUSG00000051506

Gene Name

WD repeat and FYVE domain containing 4

Synonyms

MMRRC Submission

041915-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4655 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32959547-33185508 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32989936 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 2375 (R2375G)

Ref Sequence

ENSEMBL: ENSMUSP00000057556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038956] [ENSMUST00000061753] [ENSMUST00000120588] [ENSMUST00000120866] [ENSMUST00000120951] [ENSMUST00000123822] [ENSMUST00000130509]

Predicted Effect

probably benign
Transcript: ENSMUST00000038956

SMART Domains

Protein: ENSMUSP00000041199
Gene: ENSMUSG00000041673

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
LRR	49	71	3.27e1	SMART
LRR	72	95	1.31e0	SMART
Pfam:LRR_7	96	114	3.5e-2	PFAM
LRR	120	142	1.26e2	SMART
LRR	143	166	1.49e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000061753
AA Change: R2375G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: R2375G

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
low complexity region	1899	1909	N/A	INTRINSIC
Pfam:PH_BEACH	2237	2348	1.2e-9	PFAM
Beach	2378	2660	3.69e-196	SMART
WD40	2761	2801	1.98e1	SMART
WD40	2811	2850	5.18e-7	SMART
WD40	2853	2891	9.94e-1	SMART
WD40	2893	2940	3.17e-2	SMART
WD40	2986	3021	3.31e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120588

SMART Domains

Protein: ENSMUSP00000113825
Gene: ENSMUSG00000041673

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120866

SMART Domains

Protein: ENSMUSP00000113608
Gene: ENSMUSG00000041673

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
LRR	49	71	3.27e1	SMART
LRR	72	95	1.31e0	SMART
Pfam:LRR_7	96	114	5.3e-2	PFAM
LRR	120	142	1.26e2	SMART
LRR	143	166	1.49e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120951

SMART Domains

Protein: ENSMUSP00000113965
Gene: ENSMUSG00000041673

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
LRR	49	71	3.27e1	SMART
LRR	72	95	1.31e0	SMART
LRR	120	142	1.26e2	SMART
LRR	143	166	1.49e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123822

SMART Domains

Protein: ENSMUSP00000123178
Gene: ENSMUSG00000041673

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
LRR	49	71	3.27e1	SMART
LRR	72	95	1.31e0	SMART
Pfam:LRR_7	96	110	4.6e-2	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130509
AA Change: R2534G

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: R2534G

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1596	1615	N/A	INTRINSIC
low complexity region	1795	1819	N/A	INTRINSIC
low complexity region	2019	2029	N/A	INTRINSIC
Pfam:PH_BEACH	2362	2473	1.2e-9	PFAM
Beach	2503	2785	3.69e-196	SMART
WD40	2886	2926	1.98e1	SMART
WD40	2936	2975	5.18e-7	SMART
WD40	2978	3016	9.94e-1	SMART
WD40	3018	3065	3.17e-2	SMART
WD40	3111	3146	3.31e0	SMART

Meta Mutation Damage Score

0.3055

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

96% (79/82)

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	G	2: 151,472,858	V300A	probably benign	Het
Abca4	A	G	3: 122,147,498	N405S	possibly damaging	Het
Acsl3	A	G	1: 78,690,346	T212A	probably damaging	Het
Ahnak	A	G	19: 9,008,701	K2450E	probably damaging	Het
Akap9	G	A	5: 4,046,403	R2426H	probably benign	Het
Akr1c6	T	C	13: 4,449,429	V266A	probably damaging	Het
Ccs	A	G	19: 4,839,204	V11A	probably benign	Het
Cdc14a	T	A	3: 116,328,487	H228L	probably damaging	Het
Cgn	G	A	3: 94,779,249	Q248*	probably null	Het
Cux2	G	A	5: 121,885,934	T92M	possibly damaging	Het
Cyb5r4	A	G	9: 87,059,429	K68E	probably benign	Het
Dcaf10	G	A	4: 45,372,769	R394Q	possibly damaging	Het
Dnah9	T	C	11: 65,955,732	N2918S	probably benign	Het
Dyrk1b	T	C	7: 28,185,751	V438A	probably damaging	Het
Eml1	G	A	12: 108,534,713	D625N	probably damaging	Het
Eno2	T	C	6: 124,763,926		probably null	Het
Ephb3	G	A	16: 21,222,208	G672D	probably damaging	Het
Evx1	A	T	6: 52,314,197	D118V	probably damaging	Het
Fbxl13	A	G	5: 21,582,039	L300S	probably damaging	Het
Fbxo30	T	C	10: 11,291,093	F520L	probably damaging	Het
Flt3	G	A	5: 147,349,593	P728S	possibly damaging	Het
Gas2l2	T	C	11: 83,423,175	E437G	possibly damaging	Het
Gldc	A	T	19: 30,160,702		probably benign	Het
Gm10334	T	A	6: 41,446,050	I6F	probably benign	Het
Gm13124	A	T	4: 144,555,075	F382L	probably benign	Het
Gm18856	T	C	13: 13,965,647		probably benign	Het
Gm7358	A	T	17: 14,059,148		noncoding transcript	Het
Grifin	A	G	5: 140,564,545	V47A	possibly damaging	Het
Hddc2	G	T	10: 31,328,020		probably benign	Het
Hist1h3f	T	C	13: 23,544,753	V90A	probably benign	Het
Hkdc1	T	A	10: 62,400,463	R433S	probably benign	Het
Htt	A	G	5: 34,906,132	D2918G	probably benign	Het
Itga2	A	C	13: 114,873,269	D383E	probably benign	Het
Itpr1	G	A	6: 108,481,293	C2007Y	probably damaging	Het
Krt42	C	A	11: 100,269,845	Q9H	probably damaging	Het
Lyrm7	T	C	11: 54,848,608	Q72R	probably damaging	Het
Mmp9	A	G	2: 164,951,202	S424G	probably benign	Het
Mtr	A	G	13: 12,227,793	V457A	probably damaging	Het
Myo15b	T	C	11: 115,890,697	L1359P	probably damaging	Het
Neb	A	G	2: 52,227,299	L4087P	probably damaging	Het
Npl	T	C	1: 153,515,406	D201G	probably damaging	Het
Olfr1047	A	G	2: 86,228,693	S93P	probably benign	Het
Olfr366	A	G	2: 37,219,873	N128S	probably benign	Het
Olfr905	C	A	9: 38,472,824	P26T	probably damaging	Het
Pclo	T	C	5: 14,682,383		probably benign	Het
Pdp2	A	G	8: 104,594,536	D339G	probably benign	Het
Pfdn6	A	T	17: 33,940,040	Y16*	probably null	Het
Pilra	C	T	5: 137,835,326		probably null	Het
Prrc2a	A	T	17: 35,155,614	N1353K	probably benign	Het
Ptger4	C	A	15: 5,243,064	A50S	probably benign	Het
Pus10	T	C	11: 23,672,707	V109A	probably benign	Het
Pus3	A	C	9: 35,564,932	D39A	probably benign	Het
Rab44	A	G	17: 29,139,194	N119D	probably benign	Het
Rasgrp2	T	C	19: 6,404,846		probably benign	Het
Rhobtb2	T	A	14: 69,795,989	I511F	probably damaging	Het
Sfxn1	C	A	13: 54,092,438	A167D	probably benign	Het
Slc12a6	A	G	2: 112,357,766		probably null	Het
Smyd4	C	T	11: 75,390,732	L344F	probably damaging	Het
Srsf11	A	G	3: 158,023,335	V93A	probably benign	Het
Tle1	A	G	4: 72,145,344	I224T	possibly damaging	Het
Tmc6	A	T	11: 117,773,042	S479R	possibly damaging	Het
Tmprss4	T	C	9: 45,176,404	M296V	probably benign	Het
Togaram1	A	G	12: 64,967,120	N382D	possibly damaging	Het
Tpcn1	A	G	5: 120,539,257	S662P	probably damaging	Het
Tppp	G	T	13: 74,030,864	R141S	probably benign	Het
Ttc21a	A	G	9: 119,961,762	D858G	possibly damaging	Het
Tuba3a	A	G	6: 125,281,167	S287P	possibly damaging	Het
Unc80	T	G	1: 66,671,662	S2697A	probably benign	Het
Vmn1r69	A	G	7: 10,580,099	V235A	probably benign	Het
Vmn2r26	T	A	6: 124,061,416	I650N	probably damaging	Het
Vmn2r53	G	A	7: 12,582,005	T629I	possibly damaging	Het
Vmn2r74	T	C	7: 85,961,347	T46A	probably benign	Het
Vmn2r84	A	T	10: 130,394,104	C46*	probably null	Het
Vps13b	T	C	15: 35,770,689	S2093P	probably benign	Het
Wnk2	T	G	13: 49,056,883	E1820A	probably damaging	Het

Other mutations in Wdfy4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Wdfy4	APN	14	33102539	missense	possibly damaging	0.93
IGL01116:Wdfy4	APN	14	32959977	missense	probably damaging	1.00
IGL01449:Wdfy4	APN	14	33104037	missense	probably damaging	0.99
IGL01567:Wdfy4	APN	14	33151661	missense	probably benign	0.01
IGL01700:Wdfy4	APN	14	33020238	splice site	probably benign
IGL01931:Wdfy4	APN	14	33155753	missense	probably damaging	1.00
IGL01981:Wdfy4	APN	14	33133716	missense	probably damaging	1.00
IGL01988:Wdfy4	APN	14	33076480	missense	possibly damaging	0.75
IGL02026:Wdfy4	APN	14	33093300	missense	probably damaging	1.00
IGL02066:Wdfy4	APN	14	33149566	missense	probably benign
IGL02468:Wdfy4	APN	14	32966432	missense	probably benign	0.01
IGL02512:Wdfy4	APN	14	33042491	missense	probably benign	0.01
IGL02597:Wdfy4	APN	14	33090861	nonsense	probably null
IGL02752:Wdfy4	APN	14	33076326	missense	probably damaging	1.00
IGL02792:Wdfy4	APN	14	33095305	missense	probably benign	0.01
IGL02826:Wdfy4	APN	14	32971750	missense	possibly damaging	0.47
IGL02903:Wdfy4	APN	14	33109650	missense	probably damaging	1.00
IGL02955:Wdfy4	APN	14	33076284	missense	probably damaging	1.00
IGL03031:Wdfy4	APN	14	33140651	missense	probably damaging	1.00
IGL03102:Wdfy4	APN	14	32966435	missense	probably damaging	1.00
IGL03123:Wdfy4	APN	14	33162870	missense	probably benign	0.01
IGL03198:Wdfy4	APN	14	33125887	missense	probably damaging	1.00
IGL03250:Wdfy4	APN	14	32977167	missense	probably damaging	0.99
IGL03277:Wdfy4	APN	14	33068904	missense	probably benign	0.01
IGL03398:Wdfy4	APN	14	33047290	missense	probably benign	0.14
dodgers	UTSW	14	32977106	nonsense	probably null
Dollar	UTSW	14	33020311	missense	probably damaging	1.00
Giants	UTSW	14	33070618	nonsense	probably null
gigantea	UTSW	14	32974154	critical splice donor site	probably null
kings_canyon	UTSW	14	33109519	nonsense	probably null
moro	UTSW	14	32964626	splice site	probably null
sequoia	UTSW	14	33100903	critical splice donor site	probably null
Sherman	UTSW	14	33095951	missense	possibly damaging	0.89
watchtower	UTSW	14	33083639	critical splice donor site	probably null
R0014:Wdfy4	UTSW	14	33107173	missense	possibly damaging	0.72
R0067:Wdfy4	UTSW	14	33162751	missense	probably null	1.00
R0085:Wdfy4	UTSW	14	33078243	missense	possibly damaging	0.81
R0277:Wdfy4	UTSW	14	33083785	missense	possibly damaging	0.83
R0436:Wdfy4	UTSW	14	33083812	splice site	probably benign
R0496:Wdfy4	UTSW	14	33140738	splice site	probably benign
R0514:Wdfy4	UTSW	14	33080775	missense	probably benign	0.22
R0548:Wdfy4	UTSW	14	33042621	missense	probably benign
R0590:Wdfy4	UTSW	14	33041174	missense	probably benign	0.09
R0647:Wdfy4	UTSW	14	33109699	missense	possibly damaging	0.96
R0766:Wdfy4	UTSW	14	33140612	missense	probably damaging	1.00
R0981:Wdfy4	UTSW	14	33147092	missense	probably benign	0.03
R1024:Wdfy4	UTSW	14	33079966	missense	possibly damaging	0.81
R1113:Wdfy4	UTSW	14	32971738	missense	possibly damaging	0.47
R1252:Wdfy4	UTSW	14	32971772	splice site	probably null
R1415:Wdfy4	UTSW	14	33041180	missense	possibly damaging	0.60
R1475:Wdfy4	UTSW	14	33108688	missense	probably benign	0.14
R1483:Wdfy4	UTSW	14	33100966	missense	probably benign	0.41
R1490:Wdfy4	UTSW	14	33152538	critical splice donor site	probably null
R1512:Wdfy4	UTSW	14	32960808	missense	probably damaging	0.98
R1615:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R1628:Wdfy4	UTSW	14	32959961	missense	probably damaging	1.00
R1643:Wdfy4	UTSW	14	33073585	critical splice acceptor site	probably null
R1729:Wdfy4	UTSW	14	33096005	missense	possibly damaging	0.85
R1859:Wdfy4	UTSW	14	33103983	missense	probably damaging	0.99
R1933:Wdfy4	UTSW	14	33133344	missense	probably benign	0.08
R1957:Wdfy4	UTSW	14	32971684	missense	probably damaging	1.00
R1968:Wdfy4	UTSW	14	33106044	missense	possibly damaging	0.95
R2032:Wdfy4	UTSW	14	33146989	missense	probably benign	0.11
R2241:Wdfy4	UTSW	14	33073511	missense	possibly damaging	0.81
R2391:Wdfy4	UTSW	14	33162807	missense	possibly damaging	0.92
R2888:Wdfy4	UTSW	14	33109519	nonsense	probably null
R2889:Wdfy4	UTSW	14	33109519	nonsense	probably null
R3114:Wdfy4	UTSW	14	33089903	missense	probably damaging	0.97
R3757:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3758:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3797:Wdfy4	UTSW	14	33140645	missense	probably damaging	1.00
R3890:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3892:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3945:Wdfy4	UTSW	14	32966395	missense	probably damaging	0.99
R4011:Wdfy4	UTSW	14	33102680	splice site	probably benign
R4091:Wdfy4	UTSW	14	33125880	missense	possibly damaging	0.93
R4449:Wdfy4	UTSW	14	33096083	missense	probably damaging	1.00
R4585:Wdfy4	UTSW	14	33087955	missense	possibly damaging	0.89
R4628:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4629:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4689:Wdfy4	UTSW	14	33109548	missense	possibly damaging	0.88
R4718:Wdfy4	UTSW	14	33145316	missense	probably benign	0.03
R4862:Wdfy4	UTSW	14	33100903	critical splice donor site	probably null
R4884:Wdfy4	UTSW	14	32988895	nonsense	probably null
R4894:Wdfy4	UTSW	14	33155760	missense	probably benign	0.03
R4929:Wdfy4	UTSW	14	33047256	missense	possibly damaging	0.90
R4932:Wdfy4	UTSW	14	33029013	missense	probably damaging	1.00
R5014:Wdfy4	UTSW	14	33100940	missense	probably benign	0.02
R5020:Wdfy4	UTSW	14	33079935	missense	probably damaging	1.00
R5049:Wdfy4	UTSW	14	33152670	missense	possibly damaging	0.78
R5276:Wdfy4	UTSW	14	33047275	missense	probably damaging	1.00
R5318:Wdfy4	UTSW	14	33078343	missense	possibly damaging	0.95
R5338:Wdfy4	UTSW	14	33090866	missense	probably damaging	1.00
R5349:Wdfy4	UTSW	14	32988899	missense	probably damaging	1.00
R5411:Wdfy4	UTSW	14	32960002	missense	probably damaging	1.00
R5435:Wdfy4	UTSW	14	33020311	missense	probably damaging	1.00
R5463:Wdfy4	UTSW	14	33151732	missense	probably benign	0.17
R5591:Wdfy4	UTSW	14	33107130	missense	probably benign	0.09
R5598:Wdfy4	UTSW	14	33133497	missense	probably damaging	1.00
R5654:Wdfy4	UTSW	14	33107618	splice site	probably null
R5890:Wdfy4	UTSW	14	33102577	missense	possibly damaging	0.91
R5894:Wdfy4	UTSW	14	33133360	missense	possibly damaging	0.86
R5964:Wdfy4	UTSW	14	33106011	missense	probably damaging	1.00
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6074:Wdfy4	UTSW	14	33083639	critical splice donor site	probably null
R6135:Wdfy4	UTSW	14	32971711	missense	probably damaging	0.99
R6276:Wdfy4	UTSW	14	33109525	missense	possibly damaging	0.54
R6357:Wdfy4	UTSW	14	33101049	nonsense	probably null
R6370:Wdfy4	UTSW	14	33068850	missense	probably benign	0.16
R6390:Wdfy4	UTSW	14	33104094	missense	probably damaging	0.99
R6413:Wdfy4	UTSW	14	32967647	missense	probably damaging	1.00
R6450:Wdfy4	UTSW	14	33108692	missense	probably damaging	1.00
R6522:Wdfy4	UTSW	14	33146944	missense	probably damaging	0.98
R6657:Wdfy4	UTSW	14	33047251	missense	possibly damaging	0.70
R6761:Wdfy4	UTSW	14	33095951	missense	possibly damaging	0.89
R6763:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R6952:Wdfy4	UTSW	14	32959966	missense	probably damaging	1.00
R6985:Wdfy4	UTSW	14	33099117	missense	possibly damaging	0.68
R7024:Wdfy4	UTSW	14	32964626	splice site	probably null
R7101:Wdfy4	UTSW	14	32960820	missense
R7114:Wdfy4	UTSW	14	32971574	splice site	probably null
R7139:Wdfy4	UTSW	14	33151578	missense
R7255:Wdfy4	UTSW	14	32974282	missense
R7324:Wdfy4	UTSW	14	33047314	missense
R7379:Wdfy4	UTSW	14	33151609	missense
R7399:Wdfy4	UTSW	14	33068906	missense
R7408:Wdfy4	UTSW	14	33078307	missense
R7410:Wdfy4	UTSW	14	32974234	missense
R7411:Wdfy4	UTSW	14	33106131	missense
R7412:Wdfy4	UTSW	14	33149584	missense
R7445:Wdfy4	UTSW	14	33070618	nonsense	probably null
R7595:Wdfy4	UTSW	14	32974154	critical splice donor site	probably null
R7618:Wdfy4	UTSW	14	32985739	missense
R7622:Wdfy4	UTSW	14	33078274	missense
R7828:Wdfy4	UTSW	14	32988921	missense	possibly damaging	0.90
R7888:Wdfy4	UTSW	14	33090963	missense
R7946:Wdfy4	UTSW	14	33070748	missense
R7946:Wdfy4	UTSW	14	33104115	missense
R7986:Wdfy4	UTSW	14	33104115	missense
R7990:Wdfy4	UTSW	14	33097795	missense
R8001:Wdfy4	UTSW	14	32973535	critical splice donor site	probably null
R8010:Wdfy4	UTSW	14	32971627	missense
R8015:Wdfy4	UTSW	14	33107747	missense
R8032:Wdfy4	UTSW	14	33029086	nonsense	probably null
R8041:Wdfy4	UTSW	14	33154008	critical splice donor site	probably null
R8090:Wdfy4	UTSW	14	33104115	missense
R8092:Wdfy4	UTSW	14	33104115	missense
R8112:Wdfy4	UTSW	14	33104115	missense
R8114:Wdfy4	UTSW	14	33104115	missense
R8115:Wdfy4	UTSW	14	33104115	missense
R8117:Wdfy4	UTSW	14	32977106	nonsense	probably null
R8117:Wdfy4	UTSW	14	33104115	missense
R8118:Wdfy4	UTSW	14	33104115	missense
R8140:Wdfy4	UTSW	14	33142360	missense
R8155:Wdfy4	UTSW	14	33162819	missense
R8163:Wdfy4	UTSW	14	33151588	missense
R8293:Wdfy4	UTSW	14	32974261	missense
R8325:Wdfy4	UTSW	14	32967487	missense
R8353:Wdfy4	UTSW	14	32973624	missense	probably benign
R8370:Wdfy4	UTSW	14	33093251	missense
R8437:Wdfy4	UTSW	14	33076375	missense
R8497:Wdfy4	UTSW	14	32966399	missense	probably damaging	0.99
R8545:Wdfy4	UTSW	14	33078301	missense	probably benign	0.01
X0028:Wdfy4	UTSW	14	33080636	missense	probably benign
X0053:Wdfy4	UTSW	14	33162942	start codon destroyed	probably null	0.99
X0062:Wdfy4	UTSW	14	33107618	splice site	probably null
Z1177:Wdfy4	UTSW	14	33087985	missense

Predicted Primers

PCR Primer
(F):5'- TTCTCTGGGTCATCGTCAAAGAC -3'
(R):5'- GTCTGTGCTGACCTCTGAAAAC -3'

Sequencing Primer
(F):5'- CATCCTGAGATCTTGTCAGAGACAG -3'
(R):5'- GCTGACCTCTGAAAACTGTCAAATG -3'

Posted On

2015-10-08