Incidental Mutation 'R4656:Ifi204'
ID352404
Institutional Source Beutler Lab
Gene Symbol Ifi204
Ensembl Gene ENSMUSG00000073489
Gene Nameinterferon activated gene 204
Synonymsp204
MMRRC Submission 041916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4656 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173747293-173766943 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 173760361 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111214]
Predicted Effect probably benign
Transcript: ENSMUST00000111214
SMART Domains Protein: ENSMUSP00000106845
Gene: ENSMUSG00000073489

DomainStartEndE-ValueType
PYRIN 6 84 8.33e-14 SMART
low complexity region 120 154 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:HIN 225 393 6.2e-78 PFAM
Pfam:HIN 429 595 9.8e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192414
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (80/83)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,981,616 R59H probably benign Het
2310003L06Rik G A 5: 87,964,675 probably benign Het
4931406B18Rik T A 7: 43,501,141 H69L probably benign Het
Ace2 T C X: 164,153,114 S84P probably benign Het
Adgb A C 10: 10,405,306 N656K probably damaging Het
Ago3 G T 4: 126,363,752 Y495* probably null Het
Ahnak G A 19: 9,004,855 V1168M possibly damaging Het
Armc10 A G 5: 21,661,550 R271G probably benign Het
Atp4a T G 7: 30,719,948 probably benign Het
C87499 T C 4: 88,629,965 T68A probably benign Het
Casp1 C T 9: 5,304,324 P333S probably damaging Het
Ceacam9 C T 7: 16,723,649 A34V probably benign Het
Ces1b C G 8: 93,057,414 E488Q probably damaging Het
Ces2h A T 8: 105,014,639 T88S possibly damaging Het
Col2a1 C T 15: 97,976,176 G1375D unknown Het
Cyp1a1 T C 9: 57,702,610 F436L probably damaging Het
Dcaf7 T C 11: 106,053,798 V269A probably damaging Het
Disp2 T C 2: 118,790,563 L592P probably damaging Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Egln2 A G 7: 27,159,193 V408A probably benign Het
Gabpb2 A G 3: 95,188,941 L325P probably damaging Het
Gigyf1 C A 5: 137,525,215 Y936* probably null Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gnl2 C T 4: 125,040,997 Q149* probably null Het
Gpr107 C T 2: 31,214,249 T522M probably damaging Het
Grpr T A X: 163,514,996 S351C probably damaging Het
Gsdma T C 11: 98,673,081 L287P probably damaging Het
Herc1 A G 9: 66,394,711 T652A probably damaging Het
Irx2 T C 13: 72,631,298 S234P probably damaging Het
Itgal T A 7: 127,322,553 D808E probably damaging Het
Krt13 C A 11: 100,119,363 R264L probably damaging Het
March1 T A 8: 66,386,419 L38I probably benign Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Mif4gd G T 11: 115,608,337 probably benign Het
Mroh9 A T 1: 163,066,024 M194K probably damaging Het
Nhlrc3 A G 3: 53,463,080 S22P probably damaging Het
Nipal2 A T 15: 34,577,568 probably null Het
Nr1h4 A G 10: 89,498,253 S78P probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr390 A T 11: 73,787,511 D191V probably damaging Het
Olfr607 C T 7: 103,460,488 R235Q probably benign Het
Olfr908 A T 9: 38,516,556 N175Y probably damaging Het
Pdzd2 A G 15: 12,385,711 V991A probably benign Het
Pex1 G A 5: 3,604,880 probably null Het
Plch1 G T 3: 63,704,177 A859E probably damaging Het
Ranbp2 A G 10: 58,453,422 K84R possibly damaging Het
Rbm14 T C 19: 4,811,435 Y25C probably damaging Het
Rmi2 A G 16: 10,835,322 D78G probably damaging Het
Serpina3k C A 12: 104,345,273 T370K probably damaging Het
Shc2 A T 10: 79,621,169 L538M probably damaging Het
Skint1 A G 4: 112,021,477 K202R probably damaging Het
Slc22a29 C A 19: 8,218,300 S125I possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slco4c1 A T 1: 96,841,245 D297E probably benign Het
Slco6d1 T C 1: 98,423,203 F136S probably benign Het
Smg1 A T 7: 118,212,951 V39E probably benign Het
Spns1 G T 7: 126,374,302 probably benign Het
Spsb1 A G 4: 149,906,410 probably null Het
Sspo T G 6: 48,454,076 I631S possibly damaging Het
Syne2 T C 12: 76,031,373 L4694P probably damaging Het
Taf5l T C 8: 123,998,105 E325G probably benign Het
Tars A T 15: 11,394,264 S96T probably damaging Het
Tdrd12 T C 7: 35,485,254 K745E probably damaging Het
Tenm3 A G 8: 48,293,726 Y1015H probably damaging Het
Trpv3 T A 11: 73,295,414 M677K probably damaging Het
Txlnb A T 10: 17,815,276 K191N probably damaging Het
Ubr1 A G 2: 120,926,013 V711A probably benign Het
Uqcrb T C 13: 66,901,539 T41A probably benign Het
Usp6nl A G 2: 6,441,162 Y627C probably damaging Het
Vezf1 A G 11: 88,074,667 D245G probably damaging Het
Vmn2r66 A G 7: 85,011,996 W9R possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Wrn A T 8: 33,335,991 probably null Het
Zfy1 T G Y: 729,626 T339P unknown Het
Other mutations in Ifi204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Ifi204 APN 1 173759631 splice site probably benign
IGL01922:Ifi204 APN 1 173761722 missense possibly damaging 0.51
IGL02296:Ifi204 APN 1 173749314 missense possibly damaging 0.93
IGL02419:Ifi204 APN 1 173749380 missense possibly damaging 0.71
IGL02505:Ifi204 APN 1 173755654 missense probably benign 0.04
R0938:Ifi204 UTSW 1 173751745 missense possibly damaging 0.85
R1363:Ifi204 UTSW 1 173749296 missense probably benign 0.00
R1834:Ifi204 UTSW 1 173747606 missense unknown
R2031:Ifi204 UTSW 1 173752777 missense probably damaging 1.00
R2254:Ifi204 UTSW 1 173761730 missense possibly damaging 0.95
R2379:Ifi204 UTSW 1 173755993 nonsense probably null
R2408:Ifi204 UTSW 1 173755632 missense possibly damaging 0.80
R3011:Ifi204 UTSW 1 173751651 missense probably benign 0.01
R3617:Ifi204 UTSW 1 173755717 missense possibly damaging 0.51
R3894:Ifi204 UTSW 1 173749208 missense possibly damaging 0.86
R3916:Ifi204 UTSW 1 173755775 missense possibly damaging 0.95
R4657:Ifi204 UTSW 1 173760361 intron probably benign
R4694:Ifi204 UTSW 1 173749259 missense probably damaging 0.99
R4703:Ifi204 UTSW 1 173760361 intron probably benign
R4704:Ifi204 UTSW 1 173760361 intron probably benign
R4894:Ifi204 UTSW 1 173760242 missense probably damaging 0.98
R4947:Ifi204 UTSW 1 173755750 missense probably damaging 0.98
R5023:Ifi204 UTSW 1 173751740 missense possibly damaging 0.93
R5036:Ifi204 UTSW 1 173752745 missense possibly damaging 0.79
R5119:Ifi204 UTSW 1 173755668 missense probably damaging 1.00
R5194:Ifi204 UTSW 1 173749344 missense possibly damaging 0.86
R5762:Ifi204 UTSW 1 173752759 missense probably damaging 0.98
R6063:Ifi204 UTSW 1 173751657 missense probably benign 0.03
R6808:Ifi204 UTSW 1 173761703 missense probably benign 0.27
R7311:Ifi204 UTSW 1 173759568 missense probably benign 0.26
R7338:Ifi204 UTSW 1 173760137 missense possibly damaging 0.67
R7430:Ifi204 UTSW 1 173755681 missense probably benign 0.43
R7528:Ifi204 UTSW 1 173751840 missense probably benign 0.06
Z1176:Ifi204 UTSW 1 173751628 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGCTGTGGAAGTCTCTTC -3'
(R):5'- TGAGATACATGGGCTTCAAGAG -3'

Sequencing Primer
(F):5'- CCTGGGTTGCAGAAGTCTC -3'
(R):5'- CTTCAAGAGCAGGAAGGGATTTCTC -3'
Posted On2015-10-08