Incidental Mutation 'R4656:Marchf1'
ID 352440
Institutional Source Beutler Lab
Gene Symbol Marchf1
Ensembl Gene ENSMUSG00000036469
Gene Name membrane associated ring-CH-type finger 1
Synonyms March1, 2900024D24Rik
MMRRC Submission 041916-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R4656 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 66070552-66924289 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66839071 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 38 (L38I)
Ref Sequence ENSEMBL: ENSMUSP00000105882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110258] [ENSMUST00000110259] [ENSMUST00000178982]
AlphaFold Q6NZQ8
Predicted Effect probably benign
Transcript: ENSMUST00000039540
AA Change: L38I

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469
AA Change: L38I

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072482
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098708
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110253
AA Change: L38I

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469
AA Change: L38I

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110255
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110256
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110258
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152320
Predicted Effect probably benign
Transcript: ENSMUST00000110259
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178982
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G A 5: 88,112,534 (GRCm39) probably benign Het
4931406B18Rik T A 7: 43,150,565 (GRCm39) H69L probably benign Het
Ace2 T C X: 162,936,110 (GRCm39) S84P probably benign Het
Adgb A C 10: 10,281,050 (GRCm39) N656K probably damaging Het
Ago3 G T 4: 126,257,545 (GRCm39) Y495* probably null Het
Ahnak G A 19: 8,982,219 (GRCm39) V1168M possibly damaging Het
Armc10 A G 5: 21,866,548 (GRCm39) R271G probably benign Het
Atp4a T G 7: 30,419,373 (GRCm39) probably benign Het
Casp1 C T 9: 5,304,324 (GRCm39) P333S probably damaging Het
Ceacam9 C T 7: 16,457,574 (GRCm39) A34V probably benign Het
Ces1b C G 8: 93,784,042 (GRCm39) E488Q probably damaging Het
Ces2h A T 8: 105,741,271 (GRCm39) T88S possibly damaging Het
Cfap410 G A 10: 77,817,450 (GRCm39) R59H probably benign Het
Col2a1 C T 15: 97,874,057 (GRCm39) G1375D unknown Het
Cyp1a1 T C 9: 57,609,893 (GRCm39) F436L probably damaging Het
Dcaf7 T C 11: 105,944,624 (GRCm39) V269A probably damaging Het
Disp2 T C 2: 118,621,044 (GRCm39) L592P probably damaging Het
Eda2r T A X: 96,385,239 (GRCm39) Q171L probably damaging Het
Egln2 A G 7: 26,858,618 (GRCm39) V408A probably benign Het
Gabpb2 A G 3: 95,096,252 (GRCm39) L325P probably damaging Het
Gigyf1 C A 5: 137,523,477 (GRCm39) Y936* probably null Het
Gm14149 A T 2: 151,072,684 (GRCm39) noncoding transcript Het
Gnl2 C T 4: 124,934,790 (GRCm39) Q149* probably null Het
Gpr107 C T 2: 31,104,261 (GRCm39) T522M probably damaging Het
Grpr T A X: 162,297,992 (GRCm39) S351C probably damaging Het
Gsdma T C 11: 98,563,907 (GRCm39) L287P probably damaging Het
Herc1 A G 9: 66,301,993 (GRCm39) T652A probably damaging Het
Ifi204 C A 1: 173,587,927 (GRCm39) probably benign Het
Irx2 T C 13: 72,779,417 (GRCm39) S234P probably damaging Het
Itgal T A 7: 126,921,725 (GRCm39) D808E probably damaging Het
Krt13 C A 11: 100,010,189 (GRCm39) R264L probably damaging Het
Megf9 T C 4: 70,367,004 (GRCm39) H326R probably damaging Het
Mif4gd G T 11: 115,499,163 (GRCm39) probably benign Het
Mroh9 A T 1: 162,893,593 (GRCm39) M194K probably damaging Het
Nhlrc3 A G 3: 53,370,501 (GRCm39) S22P probably damaging Het
Nipal2 A T 15: 34,577,714 (GRCm39) probably null Het
Nr1h4 A G 10: 89,334,115 (GRCm39) S78P probably benign Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Olfr908 A T 9: 38,427,852 (GRCm39) N175Y probably damaging Het
Or1e30 A T 11: 73,678,337 (GRCm39) D191V probably damaging Het
Or52d13 C T 7: 103,109,695 (GRCm39) R235Q probably benign Het
Pdzd2 A G 15: 12,385,797 (GRCm39) V991A probably benign Het
Pex1 G A 5: 3,654,880 (GRCm39) probably null Het
Plch1 G T 3: 63,611,598 (GRCm39) A859E probably damaging Het
Pramel32 T C 4: 88,548,202 (GRCm39) T68A probably benign Het
Ranbp2 A G 10: 58,289,244 (GRCm39) K84R possibly damaging Het
Rbm14 T C 19: 4,861,463 (GRCm39) Y25C probably damaging Het
Rmi2 A G 16: 10,653,186 (GRCm39) D78G probably damaging Het
Serpina3k C A 12: 104,311,532 (GRCm39) T370K probably damaging Het
Shc2 A T 10: 79,457,003 (GRCm39) L538M probably damaging Het
Skint1 A G 4: 111,878,674 (GRCm39) K202R probably damaging Het
Slc22a29 C A 19: 8,195,664 (GRCm39) S125I possibly damaging Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,970 (GRCm39) D297E probably benign Het
Slco6d1 T C 1: 98,350,928 (GRCm39) F136S probably benign Het
Smg1 A T 7: 117,812,174 (GRCm39) V39E probably benign Het
Spns1 G T 7: 125,973,474 (GRCm39) probably benign Het
Spsb1 A G 4: 149,990,867 (GRCm39) probably null Het
Sspo T G 6: 48,431,010 (GRCm39) I631S possibly damaging Het
Syne2 T C 12: 76,078,147 (GRCm39) L4694P probably damaging Het
Taf5l T C 8: 124,724,844 (GRCm39) E325G probably benign Het
Tars1 A T 15: 11,394,350 (GRCm39) S96T probably damaging Het
Tdrd12 T C 7: 35,184,679 (GRCm39) K745E probably damaging Het
Tenm3 A G 8: 48,746,761 (GRCm39) Y1015H probably damaging Het
Trpv3 T A 11: 73,186,240 (GRCm39) M677K probably damaging Het
Txlnb A T 10: 17,691,024 (GRCm39) K191N probably damaging Het
Ubr1 A G 2: 120,756,494 (GRCm39) V711A probably benign Het
Uqcrb T C 13: 67,049,603 (GRCm39) T41A probably benign Het
Usp6nl A G 2: 6,445,973 (GRCm39) Y627C probably damaging Het
Vezf1 A G 11: 87,965,493 (GRCm39) D245G probably damaging Het
Vmn2r66 A G 7: 84,661,204 (GRCm39) W9R possibly damaging Het
Wdr17 C T 8: 55,134,434 (GRCm39) G349R probably damaging Het
Wdr35 T A 12: 9,066,619 (GRCm39) M749K probably benign Het
Wrn A T 8: 33,826,019 (GRCm39) probably null Het
Zfy1 T G Y: 729,626 (GRCm39) T339P unknown Het
Other mutations in Marchf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Marchf1 APN 8 66,871,529 (GRCm39) missense possibly damaging 0.88
IGL02468:Marchf1 APN 8 66,871,563 (GRCm39) missense probably damaging 1.00
R0391:Marchf1 UTSW 8 66,871,625 (GRCm39) missense probably damaging 1.00
R1500:Marchf1 UTSW 8 66,921,042 (GRCm39) missense probably damaging 1.00
R1794:Marchf1 UTSW 8 66,839,594 (GRCm39) missense possibly damaging 0.63
R2015:Marchf1 UTSW 8 66,574,473 (GRCm39) missense probably damaging 0.99
R2184:Marchf1 UTSW 8 66,840,075 (GRCm39) missense probably benign 0.07
R2273:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2274:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2275:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2314:Marchf1 UTSW 8 66,574,442 (GRCm39) start codon destroyed probably null 0.77
R3114:Marchf1 UTSW 8 66,840,033 (GRCm39) missense probably benign
R4458:Marchf1 UTSW 8 66,908,823 (GRCm39) missense probably damaging 1.00
R4773:Marchf1 UTSW 8 66,839,876 (GRCm39) missense probably benign 0.03
R4838:Marchf1 UTSW 8 66,921,015 (GRCm39) missense probably damaging 1.00
R5073:Marchf1 UTSW 8 66,839,020 (GRCm39) missense probably benign 0.03
R5507:Marchf1 UTSW 8 66,871,542 (GRCm39) missense probably damaging 1.00
R5575:Marchf1 UTSW 8 66,920,962 (GRCm39) missense probably damaging 1.00
R5916:Marchf1 UTSW 8 66,839,763 (GRCm39) missense possibly damaging 0.89
R6931:Marchf1 UTSW 8 66,921,144 (GRCm39) missense probably benign 0.03
R7350:Marchf1 UTSW 8 66,921,051 (GRCm39) nonsense probably null
R7487:Marchf1 UTSW 8 66,908,726 (GRCm39) missense probably benign 0.14
R7531:Marchf1 UTSW 8 66,838,989 (GRCm39) missense probably benign
R7563:Marchf1 UTSW 8 66,920,965 (GRCm39) missense probably damaging 1.00
R7705:Marchf1 UTSW 8 66,921,169 (GRCm39) missense probably benign 0.00
R8142:Marchf1 UTSW 8 66,908,778 (GRCm39) missense probably benign 0.07
R8337:Marchf1 UTSW 8 66,871,641 (GRCm39) missense probably damaging 1.00
R8712:Marchf1 UTSW 8 66,921,000 (GRCm39) missense probably damaging 1.00
R9188:Marchf1 UTSW 8 66,908,803 (GRCm39) nonsense probably null
R9372:Marchf1 UTSW 8 66,921,145 (GRCm39) missense probably benign 0.01
R9477:Marchf1 UTSW 8 66,871,542 (GRCm39) missense probably damaging 1.00
R9790:Marchf1 UTSW 8 66,729,339 (GRCm39) missense probably benign 0.17
R9791:Marchf1 UTSW 8 66,729,339 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGGGCAGTGCAGCATATCAG -3'
(R):5'- CATGGACAACTTATAGCAGAAGCAG -3'

Sequencing Primer
(F):5'- CAGCTGTTTCAAGTTCCCTAAATGG -3'
(R):5'- GGAGCCATAGGTTCTCACATC -3'
Posted On 2015-10-08