Incidental Mutation 'R4656:Wdr35'
ID352459
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene NameWD repeat domain 35
Synonyms4930459M12Rik
MMRRC Submission 041916-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4656 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location8973892-9028847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9016619 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 749 (M749K)
Ref Sequence ENSEMBL: ENSMUSP00000106742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113]
Predicted Effect probably benign
Transcript: ENSMUST00000085745
AA Change: M760K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: M760K

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111113
AA Change: M749K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: M749K

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161019
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,981,616 R59H probably benign Het
2310003L06Rik G A 5: 87,964,675 probably benign Het
4931406B18Rik T A 7: 43,501,141 H69L probably benign Het
Ace2 T C X: 164,153,114 S84P probably benign Het
Adgb A C 10: 10,405,306 N656K probably damaging Het
Ago3 G T 4: 126,363,752 Y495* probably null Het
Ahnak G A 19: 9,004,855 V1168M possibly damaging Het
Armc10 A G 5: 21,661,550 R271G probably benign Het
Atp4a T G 7: 30,719,948 probably benign Het
C87499 T C 4: 88,629,965 T68A probably benign Het
Casp1 C T 9: 5,304,324 P333S probably damaging Het
Ceacam9 C T 7: 16,723,649 A34V probably benign Het
Ces1b C G 8: 93,057,414 E488Q probably damaging Het
Ces2h A T 8: 105,014,639 T88S possibly damaging Het
Col2a1 C T 15: 97,976,176 G1375D unknown Het
Cyp1a1 T C 9: 57,702,610 F436L probably damaging Het
Dcaf7 T C 11: 106,053,798 V269A probably damaging Het
Disp2 T C 2: 118,790,563 L592P probably damaging Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Egln2 A G 7: 27,159,193 V408A probably benign Het
Gabpb2 A G 3: 95,188,941 L325P probably damaging Het
Gigyf1 C A 5: 137,525,215 Y936* probably null Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gnl2 C T 4: 125,040,997 Q149* probably null Het
Gpr107 C T 2: 31,214,249 T522M probably damaging Het
Grpr T A X: 163,514,996 S351C probably damaging Het
Gsdma T C 11: 98,673,081 L287P probably damaging Het
Herc1 A G 9: 66,394,711 T652A probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Irx2 T C 13: 72,631,298 S234P probably damaging Het
Itgal T A 7: 127,322,553 D808E probably damaging Het
Krt13 C A 11: 100,119,363 R264L probably damaging Het
March1 T A 8: 66,386,419 L38I probably benign Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Mif4gd G T 11: 115,608,337 probably benign Het
Mroh9 A T 1: 163,066,024 M194K probably damaging Het
Nhlrc3 A G 3: 53,463,080 S22P probably damaging Het
Nipal2 A T 15: 34,577,568 probably null Het
Nr1h4 A G 10: 89,498,253 S78P probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr390 A T 11: 73,787,511 D191V probably damaging Het
Olfr607 C T 7: 103,460,488 R235Q probably benign Het
Olfr908 A T 9: 38,516,556 N175Y probably damaging Het
Pdzd2 A G 15: 12,385,711 V991A probably benign Het
Pex1 G A 5: 3,604,880 probably null Het
Plch1 G T 3: 63,704,177 A859E probably damaging Het
Ranbp2 A G 10: 58,453,422 K84R possibly damaging Het
Rbm14 T C 19: 4,811,435 Y25C probably damaging Het
Rmi2 A G 16: 10,835,322 D78G probably damaging Het
Serpina3k C A 12: 104,345,273 T370K probably damaging Het
Shc2 A T 10: 79,621,169 L538M probably damaging Het
Skint1 A G 4: 112,021,477 K202R probably damaging Het
Slc22a29 C A 19: 8,218,300 S125I possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slco4c1 A T 1: 96,841,245 D297E probably benign Het
Slco6d1 T C 1: 98,423,203 F136S probably benign Het
Smg1 A T 7: 118,212,951 V39E probably benign Het
Spns1 G T 7: 126,374,302 probably benign Het
Spsb1 A G 4: 149,906,410 probably null Het
Sspo T G 6: 48,454,076 I631S possibly damaging Het
Syne2 T C 12: 76,031,373 L4694P probably damaging Het
Taf5l T C 8: 123,998,105 E325G probably benign Het
Tars A T 15: 11,394,264 S96T probably damaging Het
Tdrd12 T C 7: 35,485,254 K745E probably damaging Het
Tenm3 A G 8: 48,293,726 Y1015H probably damaging Het
Trpv3 T A 11: 73,295,414 M677K probably damaging Het
Txlnb A T 10: 17,815,276 K191N probably damaging Het
Ubr1 A G 2: 120,926,013 V711A probably benign Het
Uqcrb T C 13: 66,901,539 T41A probably benign Het
Usp6nl A G 2: 6,441,162 Y627C probably damaging Het
Vezf1 A G 11: 88,074,667 D245G probably damaging Het
Vmn2r66 A G 7: 85,011,996 W9R possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wrn A T 8: 33,335,991 probably null Het
Zfy1 T G Y: 729,626 T339P unknown Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R7940:Wdr35 UTSW 12 9008113 critical splice donor site probably null
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGAAGCTGCTCTCCAGAAG -3'
(R):5'- TGTTGTCATGGAATAACACATGGAG -3'

Sequencing Primer
(F):5'- AGAAGCTGGACCTGTACACCG -3'
(R):5'- TTCAAGCTCCAGGTGCAATG -3'
Posted On2015-10-08