Incidental Mutation 'R4656:Pdzd2'
ID352466
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene NamePDZ domain containing 2
SynonymsPdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission 041916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R4656 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location12359711-12739924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12385711 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 991 (V991A)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
Predicted Effect probably benign
Transcript: ENSMUST00000075317
AA Change: V991A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: V991A

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,981,616 R59H probably benign Het
2310003L06Rik G A 5: 87,964,675 probably benign Het
4931406B18Rik T A 7: 43,501,141 H69L probably benign Het
Ace2 T C X: 164,153,114 S84P probably benign Het
Adgb A C 10: 10,405,306 N656K probably damaging Het
Ago3 G T 4: 126,363,752 Y495* probably null Het
Ahnak G A 19: 9,004,855 V1168M possibly damaging Het
Armc10 A G 5: 21,661,550 R271G probably benign Het
Atp4a T G 7: 30,719,948 probably benign Het
C87499 T C 4: 88,629,965 T68A probably benign Het
Casp1 C T 9: 5,304,324 P333S probably damaging Het
Ceacam9 C T 7: 16,723,649 A34V probably benign Het
Ces1b C G 8: 93,057,414 E488Q probably damaging Het
Ces2h A T 8: 105,014,639 T88S possibly damaging Het
Col2a1 C T 15: 97,976,176 G1375D unknown Het
Cyp1a1 T C 9: 57,702,610 F436L probably damaging Het
Dcaf7 T C 11: 106,053,798 V269A probably damaging Het
Disp2 T C 2: 118,790,563 L592P probably damaging Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Egln2 A G 7: 27,159,193 V408A probably benign Het
Gabpb2 A G 3: 95,188,941 L325P probably damaging Het
Gigyf1 C A 5: 137,525,215 Y936* probably null Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gnl2 C T 4: 125,040,997 Q149* probably null Het
Gpr107 C T 2: 31,214,249 T522M probably damaging Het
Grpr T A X: 163,514,996 S351C probably damaging Het
Gsdma T C 11: 98,673,081 L287P probably damaging Het
Herc1 A G 9: 66,394,711 T652A probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Irx2 T C 13: 72,631,298 S234P probably damaging Het
Itgal T A 7: 127,322,553 D808E probably damaging Het
Krt13 C A 11: 100,119,363 R264L probably damaging Het
March1 T A 8: 66,386,419 L38I probably benign Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Mif4gd G T 11: 115,608,337 probably benign Het
Mroh9 A T 1: 163,066,024 M194K probably damaging Het
Nhlrc3 A G 3: 53,463,080 S22P probably damaging Het
Nipal2 A T 15: 34,577,568 probably null Het
Nr1h4 A G 10: 89,498,253 S78P probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr390 A T 11: 73,787,511 D191V probably damaging Het
Olfr607 C T 7: 103,460,488 R235Q probably benign Het
Olfr908 A T 9: 38,516,556 N175Y probably damaging Het
Pex1 G A 5: 3,604,880 probably null Het
Plch1 G T 3: 63,704,177 A859E probably damaging Het
Ranbp2 A G 10: 58,453,422 K84R possibly damaging Het
Rbm14 T C 19: 4,811,435 Y25C probably damaging Het
Rmi2 A G 16: 10,835,322 D78G probably damaging Het
Serpina3k C A 12: 104,345,273 T370K probably damaging Het
Shc2 A T 10: 79,621,169 L538M probably damaging Het
Skint1 A G 4: 112,021,477 K202R probably damaging Het
Slc22a29 C A 19: 8,218,300 S125I possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slco4c1 A T 1: 96,841,245 D297E probably benign Het
Slco6d1 T C 1: 98,423,203 F136S probably benign Het
Smg1 A T 7: 118,212,951 V39E probably benign Het
Spns1 G T 7: 126,374,302 probably benign Het
Spsb1 A G 4: 149,906,410 probably null Het
Sspo T G 6: 48,454,076 I631S possibly damaging Het
Syne2 T C 12: 76,031,373 L4694P probably damaging Het
Taf5l T C 8: 123,998,105 E325G probably benign Het
Tars A T 15: 11,394,264 S96T probably damaging Het
Tdrd12 T C 7: 35,485,254 K745E probably damaging Het
Tenm3 A G 8: 48,293,726 Y1015H probably damaging Het
Trpv3 T A 11: 73,295,414 M677K probably damaging Het
Txlnb A T 10: 17,815,276 K191N probably damaging Het
Ubr1 A G 2: 120,926,013 V711A probably benign Het
Uqcrb T C 13: 66,901,539 T41A probably benign Het
Usp6nl A G 2: 6,441,162 Y627C probably damaging Het
Vezf1 A G 11: 88,074,667 D245G probably damaging Het
Vmn2r66 A G 7: 85,011,996 W9R possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Wrn A T 8: 33,335,991 probably null Het
Zfy1 T G Y: 729,626 T339P unknown Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 unclassified probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12407372 missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12592163 missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12375909 missense probably benign
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTACAGAGCCTGGCAGG -3'
(R):5'- CTCTTACACAAGCAAGTGACAG -3'

Sequencing Primer
(F):5'- TCCCACCGTGGATGCTGTG -3'
(R):5'- AGCAAGTGACAGTCGCTC -3'
Posted On2015-10-08