Incidental Mutation 'R4657:Cfap65'
ID 352479
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 041917-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.720) question?
Stock # R4657 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 74964513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139950
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 119,904,304 (GRCm39) V264E possibly damaging Het
Abcg1 T A 17: 31,327,408 (GRCm39) W368R probably benign Het
Acin1 A G 14: 54,880,504 (GRCm39) I476T possibly damaging Het
Acsm1 T A 7: 119,239,917 (GRCm39) I287N possibly damaging Het
Adgrv1 C T 13: 81,553,483 (GRCm39) V5464I probably benign Het
AI429214 T A 8: 37,461,545 (GRCm39) L231Q probably damaging Het
Akp3 A G 1: 87,053,556 (GRCm39) probably benign Het
Amy2b C T 3: 113,060,793 (GRCm39) noncoding transcript Het
Apoa5 A G 9: 46,181,170 (GRCm39) Q82R probably benign Het
Arhgap44 A G 11: 64,896,278 (GRCm39) probably null Het
Arhgef38 C A 3: 132,940,442 (GRCm39) G48V probably damaging Het
Bltp3a T A 17: 28,109,079 (GRCm39) F1099L probably benign Het
Bod1l G T 5: 41,975,955 (GRCm39) N1786K probably benign Het
Cav2 A T 6: 17,281,409 (GRCm39) D17V probably null Het
Ccdc148 G T 2: 58,891,900 (GRCm39) N238K probably benign Het
Ccin A T 4: 43,984,981 (GRCm39) I463F probably damaging Het
Cd8b1 C T 6: 71,306,758 (GRCm39) H162Y possibly damaging Het
Cdh16 T A 8: 105,341,858 (GRCm39) probably null Het
Clec4n T C 6: 123,209,155 (GRCm39) probably null Het
Cpne7 T A 8: 123,861,314 (GRCm39) *558R probably null Het
Cs A G 10: 128,189,006 (GRCm39) I172V probably benign Het
Cyp2ab1 A T 16: 20,131,822 (GRCm39) L306Q probably damaging Het
D16Ertd472e A T 16: 78,344,814 (GRCm39) V98E probably damaging Het
Dcaf15 A C 8: 84,829,467 (GRCm39) S92A probably damaging Het
Dkk3 T C 7: 111,748,253 (GRCm39) probably null Het
Dnah11 A T 12: 118,156,162 (GRCm39) C163S probably benign Het
Eda2r T A X: 96,385,239 (GRCm39) Q171L probably damaging Het
Eml4 A T 17: 83,758,377 (GRCm39) K397* probably null Het
Eml6 A T 11: 29,755,108 (GRCm39) I889N possibly damaging Het
Etaa1 A T 11: 17,896,964 (GRCm39) D384E possibly damaging Het
Fzr1 T A 10: 81,203,386 (GRCm39) probably null Het
Gm13889 G T 2: 93,786,921 (GRCm39) F61L probably damaging Het
Gm14149 A T 2: 151,072,684 (GRCm39) noncoding transcript Het
Gm5828 T A 1: 16,839,642 (GRCm39) noncoding transcript Het
Gm5866 G A 5: 52,740,262 (GRCm39) noncoding transcript Het
Gp2 T C 7: 119,056,391 (GRCm39) I27M probably benign Het
Gpr83 G A 9: 14,778,279 (GRCm39) probably null Het
Gucd1 T C 10: 75,346,959 (GRCm39) N97S probably benign Het
H2bc27 C T 11: 58,839,797 (GRCm39) P11L probably benign Het
H2-Q7 T A 17: 35,661,735 (GRCm39) V326E possibly damaging Het
Haao A T 17: 84,139,774 (GRCm39) D227E possibly damaging Het
Hipk3 C T 2: 104,264,104 (GRCm39) S819N probably benign Het
Hlcs A G 16: 94,063,557 (GRCm39) V501A probably benign Het
Hmcn1 A G 1: 150,500,301 (GRCm39) Y3964H probably damaging Het
Ifi204 C A 1: 173,587,927 (GRCm39) probably benign Het
Ifi211 A G 1: 173,735,226 (GRCm39) F68L probably benign Het
Ift57 A G 16: 49,582,957 (GRCm39) probably null Het
Ighv5-12-4 A T 12: 113,725,887 (GRCm39) L112* probably null Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Il36a T A 2: 24,114,416 (GRCm39) M97K possibly damaging Het
Itsn2 A G 12: 4,763,197 (GRCm39) *1686W probably null Het
Jkamp G T 12: 72,140,823 (GRCm39) V123F probably damaging Het
Kat7 C A 11: 95,168,424 (GRCm39) V411L probably damaging Het
Kcnj5 A G 9: 32,233,973 (GRCm39) V114A probably benign Het
Krtap5-4 T A 7: 141,857,491 (GRCm39) C54S unknown Het
Lats1 T A 10: 7,581,448 (GRCm39) N744K possibly damaging Het
Lpo T C 11: 87,705,173 (GRCm39) E387G probably damaging Het
Lrba T G 3: 86,644,471 (GRCm39) M388R probably damaging Het
Lrp2 C A 2: 69,297,337 (GRCm39) R3208L probably damaging Het
Mterf1b T A 5: 4,247,176 (GRCm39) C272* probably null Het
Myh15 A T 16: 48,992,421 (GRCm39) R1632* probably null Het
Myo3b T C 2: 70,069,243 (GRCm39) V494A possibly damaging Het
Myo9a T C 9: 59,782,699 (GRCm39) probably null Het
Nelfa T G 5: 34,059,157 (GRCm39) S233R probably benign Het
Nr4a3 A T 4: 48,051,522 (GRCm39) E121V probably damaging Het
Obscn T A 11: 58,933,116 (GRCm39) E5406D probably damaging Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or1j18 T A 2: 36,624,415 (GRCm39) Y27* probably null Het
Or7e177 A C 9: 20,211,919 (GRCm39) H142P probably damaging Het
Oxct2b T C 4: 123,010,926 (GRCm39) L282P probably damaging Het
Pappa G A 4: 65,233,033 (GRCm39) probably null Het
Pcdhb14 A G 18: 37,581,900 (GRCm39) I335M possibly damaging Het
Pcsk1 T A 13: 75,280,354 (GRCm39) D726E probably damaging Het
Pkhd1 T A 1: 20,434,391 (GRCm39) Q2349L possibly damaging Het
Pkhd1l1 G A 15: 44,410,743 (GRCm39) C2750Y probably damaging Het
Ppp2r3d A G 9: 124,476,821 (GRCm38) C26R unknown Het
Prex2 T A 1: 11,136,049 (GRCm39) I74N probably benign Het
Ptgir A G 7: 16,641,071 (GRCm39) D121G probably benign Het
Pwwp3a T A 10: 80,068,848 (GRCm39) C331S probably benign Het
Ralbp1 T C 17: 66,159,686 (GRCm39) S526G probably null Het
Ric8b T C 10: 84,828,001 (GRCm39) Y442H probably damaging Het
Rpap1 C T 2: 119,605,487 (GRCm39) D385N probably benign Het
Sash1 T C 10: 8,601,424 (GRCm39) Y1177C probably damaging Het
Shroom1 T C 11: 53,356,415 (GRCm39) I363T possibly damaging Het
Slc26a9 T C 1: 131,680,876 (GRCm39) L95P probably damaging Het
Slc44a5 A G 3: 153,962,221 (GRCm39) T385A possibly damaging Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Slc7a1 T A 5: 148,289,209 (GRCm39) M13L probably benign Het
Snrpb2 A G 2: 142,912,893 (GRCm39) N172S possibly damaging Het
Spns1 G T 7: 125,973,474 (GRCm39) probably benign Het
Srsf6 T A 2: 162,775,347 (GRCm39) S86R probably benign Het
Stk25 A T 1: 93,553,378 (GRCm39) probably benign Het
Szt2 A T 4: 118,254,866 (GRCm39) C275S probably benign Het
Tcp10b T A 17: 13,292,504 (GRCm39) probably null Het
Tmem248 T A 5: 130,260,615 (GRCm39) L60H probably damaging Het
Trim27 T C 13: 21,367,930 (GRCm39) I182T probably damaging Het
Tspan10 A G 11: 120,335,324 (GRCm39) N145D probably damaging Het
Vps13d A G 4: 144,801,412 (GRCm39) F487S probably damaging Het
Wdr86 A T 5: 24,923,229 (GRCm39) D154E probably benign Het
Wfdc18 C A 11: 83,600,695 (GRCm39) A32D possibly damaging Het
Wrn A T 8: 33,826,019 (GRCm39) probably null Het
Zfp811 C A 17: 33,019,897 (GRCm39) E7* probably null Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGGGTTCAAATGTCATTC -3'
(R):5'- ACCCACTGTTTCTGGACCTG -3'

Sequencing Primer
(F):5'- AGGGTTCAAATGTCATTCTTCTTGC -3'
(R):5'- TGATTGGGACCTGCCATTCAGAC -3'
Posted On 2015-10-08