Incidental Mutation 'R4657:Myo3b'
ID 352490
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 041917-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4657 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70069243 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 494 (V494A)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect possibly damaging
Transcript: ENSMUST00000060208
AA Change: V522A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: V522A

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112243
AA Change: V494A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: V494A

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.4164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 119,904,304 (GRCm39) V264E possibly damaging Het
Abcg1 T A 17: 31,327,408 (GRCm39) W368R probably benign Het
Acin1 A G 14: 54,880,504 (GRCm39) I476T possibly damaging Het
Acsm1 T A 7: 119,239,917 (GRCm39) I287N possibly damaging Het
Adgrv1 C T 13: 81,553,483 (GRCm39) V5464I probably benign Het
AI429214 T A 8: 37,461,545 (GRCm39) L231Q probably damaging Het
Akp3 A G 1: 87,053,556 (GRCm39) probably benign Het
Amy2b C T 3: 113,060,793 (GRCm39) noncoding transcript Het
Apoa5 A G 9: 46,181,170 (GRCm39) Q82R probably benign Het
Arhgap44 A G 11: 64,896,278 (GRCm39) probably null Het
Arhgef38 C A 3: 132,940,442 (GRCm39) G48V probably damaging Het
Bltp3a T A 17: 28,109,079 (GRCm39) F1099L probably benign Het
Bod1l G T 5: 41,975,955 (GRCm39) N1786K probably benign Het
Cav2 A T 6: 17,281,409 (GRCm39) D17V probably null Het
Ccdc148 G T 2: 58,891,900 (GRCm39) N238K probably benign Het
Ccin A T 4: 43,984,981 (GRCm39) I463F probably damaging Het
Cd8b1 C T 6: 71,306,758 (GRCm39) H162Y possibly damaging Het
Cdh16 T A 8: 105,341,858 (GRCm39) probably null Het
Cfap65 T A 1: 74,964,513 (GRCm39) probably benign Het
Clec4n T C 6: 123,209,155 (GRCm39) probably null Het
Cpne7 T A 8: 123,861,314 (GRCm39) *558R probably null Het
Cs A G 10: 128,189,006 (GRCm39) I172V probably benign Het
Cyp2ab1 A T 16: 20,131,822 (GRCm39) L306Q probably damaging Het
D16Ertd472e A T 16: 78,344,814 (GRCm39) V98E probably damaging Het
Dcaf15 A C 8: 84,829,467 (GRCm39) S92A probably damaging Het
Dkk3 T C 7: 111,748,253 (GRCm39) probably null Het
Dnah11 A T 12: 118,156,162 (GRCm39) C163S probably benign Het
Eda2r T A X: 96,385,239 (GRCm39) Q171L probably damaging Het
Eml4 A T 17: 83,758,377 (GRCm39) K397* probably null Het
Eml6 A T 11: 29,755,108 (GRCm39) I889N possibly damaging Het
Etaa1 A T 11: 17,896,964 (GRCm39) D384E possibly damaging Het
Fzr1 T A 10: 81,203,386 (GRCm39) probably null Het
Gm13889 G T 2: 93,786,921 (GRCm39) F61L probably damaging Het
Gm14149 A T 2: 151,072,684 (GRCm39) noncoding transcript Het
Gm5828 T A 1: 16,839,642 (GRCm39) noncoding transcript Het
Gm5866 G A 5: 52,740,262 (GRCm39) noncoding transcript Het
Gp2 T C 7: 119,056,391 (GRCm39) I27M probably benign Het
Gpr83 G A 9: 14,778,279 (GRCm39) probably null Het
Gucd1 T C 10: 75,346,959 (GRCm39) N97S probably benign Het
H2bc27 C T 11: 58,839,797 (GRCm39) P11L probably benign Het
H2-Q7 T A 17: 35,661,735 (GRCm39) V326E possibly damaging Het
Haao A T 17: 84,139,774 (GRCm39) D227E possibly damaging Het
Hipk3 C T 2: 104,264,104 (GRCm39) S819N probably benign Het
Hlcs A G 16: 94,063,557 (GRCm39) V501A probably benign Het
Hmcn1 A G 1: 150,500,301 (GRCm39) Y3964H probably damaging Het
Ifi204 C A 1: 173,587,927 (GRCm39) probably benign Het
Ifi211 A G 1: 173,735,226 (GRCm39) F68L probably benign Het
Ift57 A G 16: 49,582,957 (GRCm39) probably null Het
Ighv5-12-4 A T 12: 113,725,887 (GRCm39) L112* probably null Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Il36a T A 2: 24,114,416 (GRCm39) M97K possibly damaging Het
Itsn2 A G 12: 4,763,197 (GRCm39) *1686W probably null Het
Jkamp G T 12: 72,140,823 (GRCm39) V123F probably damaging Het
Kat7 C A 11: 95,168,424 (GRCm39) V411L probably damaging Het
Kcnj5 A G 9: 32,233,973 (GRCm39) V114A probably benign Het
Krtap5-4 T A 7: 141,857,491 (GRCm39) C54S unknown Het
Lats1 T A 10: 7,581,448 (GRCm39) N744K possibly damaging Het
Lpo T C 11: 87,705,173 (GRCm39) E387G probably damaging Het
Lrba T G 3: 86,644,471 (GRCm39) M388R probably damaging Het
Lrp2 C A 2: 69,297,337 (GRCm39) R3208L probably damaging Het
Mterf1b T A 5: 4,247,176 (GRCm39) C272* probably null Het
Myh15 A T 16: 48,992,421 (GRCm39) R1632* probably null Het
Myo9a T C 9: 59,782,699 (GRCm39) probably null Het
Nelfa T G 5: 34,059,157 (GRCm39) S233R probably benign Het
Nr4a3 A T 4: 48,051,522 (GRCm39) E121V probably damaging Het
Obscn T A 11: 58,933,116 (GRCm39) E5406D probably damaging Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or1j18 T A 2: 36,624,415 (GRCm39) Y27* probably null Het
Or7e177 A C 9: 20,211,919 (GRCm39) H142P probably damaging Het
Oxct2b T C 4: 123,010,926 (GRCm39) L282P probably damaging Het
Pappa G A 4: 65,233,033 (GRCm39) probably null Het
Pcdhb14 A G 18: 37,581,900 (GRCm39) I335M possibly damaging Het
Pcsk1 T A 13: 75,280,354 (GRCm39) D726E probably damaging Het
Pkhd1 T A 1: 20,434,391 (GRCm39) Q2349L possibly damaging Het
Pkhd1l1 G A 15: 44,410,743 (GRCm39) C2750Y probably damaging Het
Ppp2r3d A G 9: 124,476,821 (GRCm38) C26R unknown Het
Prex2 T A 1: 11,136,049 (GRCm39) I74N probably benign Het
Ptgir A G 7: 16,641,071 (GRCm39) D121G probably benign Het
Pwwp3a T A 10: 80,068,848 (GRCm39) C331S probably benign Het
Ralbp1 T C 17: 66,159,686 (GRCm39) S526G probably null Het
Ric8b T C 10: 84,828,001 (GRCm39) Y442H probably damaging Het
Rpap1 C T 2: 119,605,487 (GRCm39) D385N probably benign Het
Sash1 T C 10: 8,601,424 (GRCm39) Y1177C probably damaging Het
Shroom1 T C 11: 53,356,415 (GRCm39) I363T possibly damaging Het
Slc26a9 T C 1: 131,680,876 (GRCm39) L95P probably damaging Het
Slc44a5 A G 3: 153,962,221 (GRCm39) T385A possibly damaging Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Slc7a1 T A 5: 148,289,209 (GRCm39) M13L probably benign Het
Snrpb2 A G 2: 142,912,893 (GRCm39) N172S possibly damaging Het
Spns1 G T 7: 125,973,474 (GRCm39) probably benign Het
Srsf6 T A 2: 162,775,347 (GRCm39) S86R probably benign Het
Stk25 A T 1: 93,553,378 (GRCm39) probably benign Het
Szt2 A T 4: 118,254,866 (GRCm39) C275S probably benign Het
Tcp10b T A 17: 13,292,504 (GRCm39) probably null Het
Tmem248 T A 5: 130,260,615 (GRCm39) L60H probably damaging Het
Trim27 T C 13: 21,367,930 (GRCm39) I182T probably damaging Het
Tspan10 A G 11: 120,335,324 (GRCm39) N145D probably damaging Het
Vps13d A G 4: 144,801,412 (GRCm39) F487S probably damaging Het
Wdr86 A T 5: 24,923,229 (GRCm39) D154E probably benign Het
Wfdc18 C A 11: 83,600,695 (GRCm39) A32D possibly damaging Het
Wrn A T 8: 33,826,019 (GRCm39) probably null Het
Zfp811 C A 17: 33,019,897 (GRCm39) E7* probably null Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCAGCATCATTGGAGTG -3'
(R):5'- AAATCAGCTACCACTGCTCCTTTG -3'

Sequencing Primer
(F):5'- ATCATTGGAGTGCGGCCTC -3'
(R):5'- CTGCCTGCTGTATAACTC -3'
Posted On 2015-10-08