Incidental Mutation 'R0270:Ddx46'
Institutional Source Beutler Lab
Gene Symbol Ddx46
Ensembl Gene ENSMUSG00000021500
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 46
MMRRC Submission 038496-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R0270 (G1)
Quality Score184
Status Validated
Chromosomal Location55635027-55681256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55674104 bp
Amino Acid Change Isoleucine to Threonine at position 863 (I863T)
Ref Sequence ENSEMBL: ENSMUSP00000097078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099479] [ENSMUST00000172272] [ENSMUST00000223736]
Predicted Effect probably benign
Transcript: ENSMUST00000099479
AA Change: I863T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097078
Gene: ENSMUSG00000021500
AA Change: I863T

low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 4e-76 BLAST
DEXDc 391 592 3.27e-49 SMART
HELICc 629 710 1.55e-27 SMART
low complexity region 760 776 N/A INTRINSIC
low complexity region 798 813 N/A INTRINSIC
internal_repeat_1 855 894 6.68e-7 PROSPERO
low complexity region 911 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172272
AA Change: I867T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133245
Gene: ENSMUSG00000021500
AA Change: I867T

low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 5e-76 BLAST
DEXDc 391 596 8.03e-67 SMART
HELICc 633 714 1.55e-27 SMART
low complexity region 764 780 N/A INTRINSIC
low complexity region 802 817 N/A INTRINSIC
internal_repeat_1 859 898 1.04e-6 PROSPERO
low complexity region 915 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223736
AA Change: I867T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224551
Predicted Effect unknown
Transcript: ENSMUST00000231097
AA Change: I133T
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 96.0%
  • 20x: 93.2%
Validation Efficiency 99% (113/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the 17S U2 snRNP complex; it plays an important role in pre-mRNA splicing. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,166,176 probably benign Het
4922502D21Rik A T 6: 129,325,608 L152* probably null Het
Abcf3 T A 16: 20,560,168 probably null Het
Acadm C T 3: 153,936,324 M190I possibly damaging Het
Adamtsl3 G A 7: 82,556,824 R739Q probably damaging Het
Ank1 T A 8: 23,088,925 probably benign Het
Ap3b1 T A 13: 94,404,118 probably benign Het
Arhgdib A G 6: 136,926,734 V31A probably damaging Het
Arid4a A G 12: 71,072,632 R342G probably damaging Het
Asic3 C T 5: 24,417,702 L517F probably benign Het
Atxn7l1 C T 12: 33,342,151 P242L possibly damaging Het
AY761185 T A 8: 20,944,600 E37D possibly damaging Het
Babam1 T A 8: 71,398,406 D104E probably damaging Het
Batf A T 12: 85,708,672 T100S probably benign Het
Blcap A T 2: 157,557,977 Y59* probably null Het
Cacnb3 G A 15: 98,642,559 A350T probably damaging Het
Cdk15 T A 1: 59,310,806 V319D probably damaging Het
Cenpf T C 1: 189,650,714 H2661R probably benign Het
Cenpq T C 17: 40,930,050 E106G probably damaging Het
Cfap43 A G 19: 47,797,203 probably benign Het
Cfb G A 17: 34,860,386 S778L possibly damaging Het
Clspn T A 4: 126,573,236 N631K probably damaging Het
Cntn2 T A 1: 132,521,724 T660S probably damaging Het
Cntrob T A 11: 69,311,341 H475L possibly damaging Het
Dnah11 G A 12: 118,041,013 T2191I probably damaging Het
Dock9 T C 14: 121,575,999 T1703A probably benign Het
Fam13c C T 10: 70,544,513 P424S probably benign Het
Fan1 T C 7: 64,348,871 N968D probably benign Het
Fbxl20 A T 11: 98,098,503 probably benign Het
Fkbp1b A T 12: 4,838,229 probably benign Het
G930045G22Rik T A 6: 50,847,059 noncoding transcript Het
Gm28042 C A 2: 120,041,592 R1008S probably benign Het
Gm6614 T A 6: 141,972,411 I580F possibly damaging Het
Gm8298 T A 3: 59,877,019 N304K probably benign Het
Gon4l G A 3: 88,858,400 S376N probably damaging Het
Gstt3 C A 10: 75,780,915 R15L probably damaging Het
Gtdc1 A T 2: 44,752,174 S73T possibly damaging Het
H2afy G A 13: 56,096,114 probably benign Het
Hhatl A G 9: 121,784,720 S419P probably benign Het
Hirip3 T G 7: 126,863,191 S46R probably damaging Het
Hsf2 A G 10: 57,502,639 T204A probably benign Het
Impg2 G A 16: 56,269,015 E1108K possibly damaging Het
Itgb2l G T 16: 96,422,930 probably benign Het
Itih5 A T 2: 10,251,264 N847I probably benign Het
Kif1a T C 1: 93,054,442 probably benign Het
Klhl1 T A 14: 96,518,344 probably benign Het
Ktn1 T A 14: 47,714,662 D963E probably benign Het
Lclat1 T A 17: 73,240,027 V313E probably benign Het
Lrrn4 T C 2: 132,870,719 S395G probably benign Het
Mbtps1 G A 8: 119,538,117 probably benign Het
Me1 A G 9: 86,596,204 probably benign Het
Mov10 C A 3: 104,795,405 C948F probably benign Het
Mterf1a G A 5: 3,890,990 Q293* probably null Het
Nfkb2 A T 19: 46,311,626 M838L possibly damaging Het
Nhlrc2 T A 19: 56,551,870 L97Q probably damaging Het
Nr6a1 A T 2: 38,739,020 Y331N possibly damaging Het
Nup214 C T 2: 32,034,814 A1785V probably damaging Het
Ogg1 C T 6: 113,329,256 T138I probably benign Het
Olfr1461 A G 19: 13,165,887 Y291C probably damaging Het
Olfr1489 A G 19: 13,633,684 Y191C probably damaging Het
Olfr202 A G 16: 59,283,753 V248A probably damaging Het
Olfr829 T A 9: 18,856,831 Y60N probably damaging Het
Plod2 G T 9: 92,584,521 R178L probably benign Het
Polr3b T A 10: 84,718,475 L1017Q probably benign Het
Postn C A 3: 54,384,550 T724N probably damaging Het
Ppm1l T G 3: 69,317,976 probably benign Het
Prpf8 T G 11: 75,505,249 L1983R probably damaging Het
Psma7 A G 2: 180,039,400 V59A probably benign Het
Qser1 T A 2: 104,788,961 Y502F probably benign Het
Rad50 T C 11: 53,668,025 D1129G probably damaging Het
Rasal1 C A 5: 120,674,729 P606Q probably damaging Het
Rgs6 A G 12: 83,133,689 Y438C probably damaging Het
Rnf180 A G 13: 105,252,266 C73R probably benign Het
Rnf216 T A 5: 143,080,241 I474F possibly damaging Het
Sdha A T 13: 74,332,247 L371Q probably damaging Het
Sdk1 T G 5: 142,084,566 L1162R possibly damaging Het
Sh3rf2 T C 18: 42,104,081 I223T probably damaging Het
Sirpb1a A G 3: 15,410,527 V316A probably damaging Het
Slc12a4 A T 8: 105,945,389 I897N probably benign Het
Slc35d1 A T 4: 103,190,838 V243E probably damaging Het
Slc4a11 T A 2: 130,690,932 K200N possibly damaging Het
Slc9a8 T A 2: 167,451,296 M188K probably damaging Het
Snrnp200 T C 2: 127,232,982 S1492P probably damaging Het
Sphk2 T C 7: 45,710,725 *618W probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tdpoz3 A G 3: 93,826,924 N302S probably benign Het
Tdrd6 T C 17: 43,624,308 M1950V probably benign Het
Tmem39a A G 16: 38,564,313 probably benign Het
Trip4 A T 9: 65,858,358 I353K probably damaging Het
Trip6 A T 5: 137,312,841 F204L probably benign Het
Trpm4 T A 7: 45,319,253 I419F possibly damaging Het
Ttn C A 2: 76,944,796 E1967D probably damaging Het
Uba2 C T 7: 34,150,856 V391M possibly damaging Het
Ubr4 T G 4: 139,479,435 probably benign Het
Upf1 G A 8: 70,335,645 probably benign Het
Vmn1r228 A C 17: 20,776,596 V220G possibly damaging Het
Vmn2r79 A G 7: 87,003,386 M429V probably benign Het
Vps36 C T 8: 22,210,456 T210I possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Ybx1 C T 4: 119,281,591 G126D probably benign Het
Yipf5 C A 18: 40,206,407 probably benign Het
Zdhhc5 A C 2: 84,690,115 S573A probably benign Het
Zfp457 A T 13: 67,293,927 C99S probably damaging Het
Zfp52 T A 17: 21,561,302 C471S probably damaging Het
Zfp558 C T 9: 18,467,956 V71I probably damaging Het
Zfp651 A G 9: 121,767,575 T666A probably benign Het
Zfp655 A G 5: 145,244,457 Y375C probably damaging Het
Zfp882 A T 8: 71,914,615 T429S probably benign Het
Zmym2 T C 14: 56,949,684 probably null Het
Other mutations in Ddx46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Ddx46 APN 13 55666332 nonsense probably null
IGL01137:Ddx46 APN 13 55669717 nonsense probably null
IGL01432:Ddx46 APN 13 55638022 splice site probably benign
IGL01575:Ddx46 APN 13 55654183 splice site probably benign
IGL01673:Ddx46 APN 13 55653048 missense probably damaging 1.00
IGL01868:Ddx46 APN 13 55639870 nonsense probably null
IGL01945:Ddx46 APN 13 55655072 nonsense probably null
IGL02106:Ddx46 APN 13 55677603 unclassified probably benign
IGL03288:Ddx46 APN 13 55638094 missense unknown
R0631:Ddx46 UTSW 13 55639777 splice site probably benign
R1082:Ddx46 UTSW 13 55655096 missense possibly damaging 0.87
R1502:Ddx46 UTSW 13 55663309 missense possibly damaging 0.89
R2081:Ddx46 UTSW 13 55674016 missense probably benign 0.00
R2256:Ddx46 UTSW 13 55647708 missense possibly damaging 0.50
R4366:Ddx46 UTSW 13 55663236 missense probably benign 0.10
R4856:Ddx46 UTSW 13 55638199 missense unknown
R4886:Ddx46 UTSW 13 55638199 missense unknown
R5001:Ddx46 UTSW 13 55652919 missense probably damaging 0.98
R5152:Ddx46 UTSW 13 55659030 missense probably damaging 1.00
R5258:Ddx46 UTSW 13 55653024 missense possibly damaging 0.95
R5278:Ddx46 UTSW 13 55676038 missense probably damaging 0.97
R5806:Ddx46 UTSW 13 55663337 missense possibly damaging 0.93
R6627:Ddx46 UTSW 13 55652935 missense probably benign 0.15
R6659:Ddx46 UTSW 13 55669724 missense probably damaging 1.00
R6838:Ddx46 UTSW 13 55639935 critical splice donor site probably null
R7235:Ddx46 UTSW 13 55663240 missense probably benign 0.01
R7537:Ddx46 UTSW 13 55650478 missense probably damaging 1.00
R7664:Ddx46 UTSW 13 55659051 missense probably damaging 1.00
R7673:Ddx46 UTSW 13 55659159 missense probably benign 0.01
R7704:Ddx46 UTSW 13 55674019 missense probably benign 0.00
R7943:Ddx46 UTSW 13 55669722 missense probably damaging 1.00
R8188:Ddx46 UTSW 13 55666216 missense possibly damaging 0.95
R8324:Ddx46 UTSW 13 55663914 missense probably damaging 1.00
R8880:Ddx46 UTSW 13 55666220 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- tcgccagcccTCGGTTAGTATTTC -3'

Sequencing Primer
(R):5'- gtaggaagtagacaggaggataag -3'
Posted On2013-05-09