Incidental Mutation 'R4657:Oxct2b'
ID 352505
Institutional Source Beutler Lab
Gene Symbol Oxct2b
Ensembl Gene ENSMUSG00000076438
Gene Name 3-oxoacid CoA transferase 2B
Synonyms Scot-t2
MMRRC Submission 041917-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R4657 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 123010059-123011793 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123010926 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 282 (L282P)
Ref Sequence ENSEMBL: ENSMUSP00000099708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002457] [ENSMUST00000102648]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000002457
SMART Domains Protein: ENSMUSP00000002457
Gene: ENSMUSG00000002384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TGFb_propeptide 26 248 2.7e-62 PFAM
TGFB 298 399 2.83e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102648
AA Change: L282P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099708
Gene: ENSMUSG00000076438
AA Change: L282P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CoA_trans 43 272 2.02e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194481
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (105/107)
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 119,904,304 (GRCm39) V264E possibly damaging Het
Abcg1 T A 17: 31,327,408 (GRCm39) W368R probably benign Het
Acin1 A G 14: 54,880,504 (GRCm39) I476T possibly damaging Het
Acsm1 T A 7: 119,239,917 (GRCm39) I287N possibly damaging Het
Adgrv1 C T 13: 81,553,483 (GRCm39) V5464I probably benign Het
AI429214 T A 8: 37,461,545 (GRCm39) L231Q probably damaging Het
Akp3 A G 1: 87,053,556 (GRCm39) probably benign Het
Amy2b C T 3: 113,060,793 (GRCm39) noncoding transcript Het
Apoa5 A G 9: 46,181,170 (GRCm39) Q82R probably benign Het
Arhgap44 A G 11: 64,896,278 (GRCm39) probably null Het
Arhgef38 C A 3: 132,940,442 (GRCm39) G48V probably damaging Het
Bltp3a T A 17: 28,109,079 (GRCm39) F1099L probably benign Het
Bod1l G T 5: 41,975,955 (GRCm39) N1786K probably benign Het
Cav2 A T 6: 17,281,409 (GRCm39) D17V probably null Het
Ccdc148 G T 2: 58,891,900 (GRCm39) N238K probably benign Het
Ccin A T 4: 43,984,981 (GRCm39) I463F probably damaging Het
Cd8b1 C T 6: 71,306,758 (GRCm39) H162Y possibly damaging Het
Cdh16 T A 8: 105,341,858 (GRCm39) probably null Het
Cfap65 T A 1: 74,964,513 (GRCm39) probably benign Het
Clec4n T C 6: 123,209,155 (GRCm39) probably null Het
Cpne7 T A 8: 123,861,314 (GRCm39) *558R probably null Het
Cs A G 10: 128,189,006 (GRCm39) I172V probably benign Het
Cyp2ab1 A T 16: 20,131,822 (GRCm39) L306Q probably damaging Het
D16Ertd472e A T 16: 78,344,814 (GRCm39) V98E probably damaging Het
Dcaf15 A C 8: 84,829,467 (GRCm39) S92A probably damaging Het
Dkk3 T C 7: 111,748,253 (GRCm39) probably null Het
Dnah11 A T 12: 118,156,162 (GRCm39) C163S probably benign Het
Eda2r T A X: 96,385,239 (GRCm39) Q171L probably damaging Het
Eml4 A T 17: 83,758,377 (GRCm39) K397* probably null Het
Eml6 A T 11: 29,755,108 (GRCm39) I889N possibly damaging Het
Etaa1 A T 11: 17,896,964 (GRCm39) D384E possibly damaging Het
Fzr1 T A 10: 81,203,386 (GRCm39) probably null Het
Gm13889 G T 2: 93,786,921 (GRCm39) F61L probably damaging Het
Gm14149 A T 2: 151,072,684 (GRCm39) noncoding transcript Het
Gm5828 T A 1: 16,839,642 (GRCm39) noncoding transcript Het
Gm5866 G A 5: 52,740,262 (GRCm39) noncoding transcript Het
Gp2 T C 7: 119,056,391 (GRCm39) I27M probably benign Het
Gpr83 G A 9: 14,778,279 (GRCm39) probably null Het
Gucd1 T C 10: 75,346,959 (GRCm39) N97S probably benign Het
H2bc27 C T 11: 58,839,797 (GRCm39) P11L probably benign Het
H2-Q7 T A 17: 35,661,735 (GRCm39) V326E possibly damaging Het
Haao A T 17: 84,139,774 (GRCm39) D227E possibly damaging Het
Hipk3 C T 2: 104,264,104 (GRCm39) S819N probably benign Het
Hlcs A G 16: 94,063,557 (GRCm39) V501A probably benign Het
Hmcn1 A G 1: 150,500,301 (GRCm39) Y3964H probably damaging Het
Ifi204 C A 1: 173,587,927 (GRCm39) probably benign Het
Ifi211 A G 1: 173,735,226 (GRCm39) F68L probably benign Het
Ift57 A G 16: 49,582,957 (GRCm39) probably null Het
Ighv5-12-4 A T 12: 113,725,887 (GRCm39) L112* probably null Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Il36a T A 2: 24,114,416 (GRCm39) M97K possibly damaging Het
Itsn2 A G 12: 4,763,197 (GRCm39) *1686W probably null Het
Jkamp G T 12: 72,140,823 (GRCm39) V123F probably damaging Het
Kat7 C A 11: 95,168,424 (GRCm39) V411L probably damaging Het
Kcnj5 A G 9: 32,233,973 (GRCm39) V114A probably benign Het
Krtap5-4 T A 7: 141,857,491 (GRCm39) C54S unknown Het
Lats1 T A 10: 7,581,448 (GRCm39) N744K possibly damaging Het
Lpo T C 11: 87,705,173 (GRCm39) E387G probably damaging Het
Lrba T G 3: 86,644,471 (GRCm39) M388R probably damaging Het
Lrp2 C A 2: 69,297,337 (GRCm39) R3208L probably damaging Het
Mterf1b T A 5: 4,247,176 (GRCm39) C272* probably null Het
Myh15 A T 16: 48,992,421 (GRCm39) R1632* probably null Het
Myo3b T C 2: 70,069,243 (GRCm39) V494A possibly damaging Het
Myo9a T C 9: 59,782,699 (GRCm39) probably null Het
Nelfa T G 5: 34,059,157 (GRCm39) S233R probably benign Het
Nr4a3 A T 4: 48,051,522 (GRCm39) E121V probably damaging Het
Obscn T A 11: 58,933,116 (GRCm39) E5406D probably damaging Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or1j18 T A 2: 36,624,415 (GRCm39) Y27* probably null Het
Or7e177 A C 9: 20,211,919 (GRCm39) H142P probably damaging Het
Pappa G A 4: 65,233,033 (GRCm39) probably null Het
Pcdhb14 A G 18: 37,581,900 (GRCm39) I335M possibly damaging Het
Pcsk1 T A 13: 75,280,354 (GRCm39) D726E probably damaging Het
Pkhd1 T A 1: 20,434,391 (GRCm39) Q2349L possibly damaging Het
Pkhd1l1 G A 15: 44,410,743 (GRCm39) C2750Y probably damaging Het
Ppp2r3d A G 9: 124,476,821 (GRCm38) C26R unknown Het
Prex2 T A 1: 11,136,049 (GRCm39) I74N probably benign Het
Ptgir A G 7: 16,641,071 (GRCm39) D121G probably benign Het
Pwwp3a T A 10: 80,068,848 (GRCm39) C331S probably benign Het
Ralbp1 T C 17: 66,159,686 (GRCm39) S526G probably null Het
Ric8b T C 10: 84,828,001 (GRCm39) Y442H probably damaging Het
Rpap1 C T 2: 119,605,487 (GRCm39) D385N probably benign Het
Sash1 T C 10: 8,601,424 (GRCm39) Y1177C probably damaging Het
Shroom1 T C 11: 53,356,415 (GRCm39) I363T possibly damaging Het
Slc26a9 T C 1: 131,680,876 (GRCm39) L95P probably damaging Het
Slc44a5 A G 3: 153,962,221 (GRCm39) T385A possibly damaging Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Slc7a1 T A 5: 148,289,209 (GRCm39) M13L probably benign Het
Snrpb2 A G 2: 142,912,893 (GRCm39) N172S possibly damaging Het
Spns1 G T 7: 125,973,474 (GRCm39) probably benign Het
Srsf6 T A 2: 162,775,347 (GRCm39) S86R probably benign Het
Stk25 A T 1: 93,553,378 (GRCm39) probably benign Het
Szt2 A T 4: 118,254,866 (GRCm39) C275S probably benign Het
Tcp10b T A 17: 13,292,504 (GRCm39) probably null Het
Tmem248 T A 5: 130,260,615 (GRCm39) L60H probably damaging Het
Trim27 T C 13: 21,367,930 (GRCm39) I182T probably damaging Het
Tspan10 A G 11: 120,335,324 (GRCm39) N145D probably damaging Het
Vps13d A G 4: 144,801,412 (GRCm39) F487S probably damaging Het
Wdr86 A T 5: 24,923,229 (GRCm39) D154E probably benign Het
Wfdc18 C A 11: 83,600,695 (GRCm39) A32D possibly damaging Het
Wrn A T 8: 33,826,019 (GRCm39) probably null Het
Zfp811 C A 17: 33,019,897 (GRCm39) E7* probably null Het
Other mutations in Oxct2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Oxct2b APN 4 123,011,301 (GRCm39) missense probably damaging 1.00
R0504:Oxct2b UTSW 4 123,010,705 (GRCm39) small deletion probably benign
R0504:Oxct2b UTSW 4 123,010,633 (GRCm39) missense possibly damaging 0.92
R0543:Oxct2b UTSW 4 123,010,782 (GRCm39) missense possibly damaging 0.93
R1167:Oxct2b UTSW 4 123,011,378 (GRCm39) missense probably damaging 0.99
R1365:Oxct2b UTSW 4 123,011,162 (GRCm39) missense probably benign
R1891:Oxct2b UTSW 4 123,010,938 (GRCm39) missense probably benign 0.01
R2311:Oxct2b UTSW 4 123,011,211 (GRCm39) missense probably damaging 1.00
R2906:Oxct2b UTSW 4 123,010,823 (GRCm39) missense probably benign 0.12
R4168:Oxct2b UTSW 4 123,011,478 (GRCm39) missense probably damaging 0.96
R6159:Oxct2b UTSW 4 123,011,244 (GRCm39) missense probably damaging 1.00
R6221:Oxct2b UTSW 4 123,010,601 (GRCm39) missense probably damaging 1.00
R6271:Oxct2b UTSW 4 123,011,508 (GRCm39) missense probably damaging 1.00
R6357:Oxct2b UTSW 4 123,010,709 (GRCm39) missense probably benign 0.00
R6389:Oxct2b UTSW 4 123,010,367 (GRCm39) missense probably benign 0.21
R6996:Oxct2b UTSW 4 123,011,480 (GRCm39) missense probably benign 0.05
R7210:Oxct2b UTSW 4 123,010,069 (GRCm39) start gained probably benign
R7655:Oxct2b UTSW 4 123,011,550 (GRCm39) missense probably benign 0.16
R7656:Oxct2b UTSW 4 123,011,550 (GRCm39) missense probably benign 0.16
R7849:Oxct2b UTSW 4 123,010,680 (GRCm39) missense probably damaging 1.00
R7934:Oxct2b UTSW 4 123,010,447 (GRCm39) nonsense probably null
R8094:Oxct2b UTSW 4 123,010,301 (GRCm39) missense possibly damaging 0.66
R8936:Oxct2b UTSW 4 123,010,838 (GRCm39) missense probably benign 0.00
R8979:Oxct2b UTSW 4 123,011,169 (GRCm39) missense probably benign 0.23
R9365:Oxct2b UTSW 4 123,010,589 (GRCm39) missense probably benign 0.03
R9523:Oxct2b UTSW 4 123,011,483 (GRCm39) missense probably damaging 1.00
R9598:Oxct2b UTSW 4 123,010,413 (GRCm39) missense possibly damaging 0.88
R9612:Oxct2b UTSW 4 123,011,019 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACTTCGCACTGATCAAGG -3'
(R):5'- AGGTAGACGGTCATCTTGGG -3'

Sequencing Primer
(F):5'- CAACGTGATCTTCAGAGGCAGC -3'
(R):5'- GGCTGATGTAGTTGCTCGCC -3'
Posted On 2015-10-08