Incidental Mutation 'R4657:Apoa5'
ID 352527
Institutional Source Beutler Lab
Gene Symbol Apoa5
Ensembl Gene ENSMUSG00000032079
Gene Name apolipoprotein A-V
Synonyms 1300007O05Rik, RAP3, Apoav
MMRRC Submission 041917-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4657 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 46179931-46183217 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46181170 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 82 (Q82R)
Ref Sequence ENSEMBL: ENSMUSP00000149877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440] [ENSMUST00000213878] [ENSMUST00000214202] [ENSMUST00000215187] [ENSMUST00000215458]
AlphaFold Q8C7G5
Predicted Effect probably benign
Transcript: ENSMUST00000034584
AA Change: Q82R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079
AA Change: Q82R

DomainStartEndE-ValueType
Pfam:Apolipoprotein 52 264 5.1e-59 PFAM
Pfam:Apolipoprotein 258 315 1.8e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114552
SMART Domains Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
Zpr1 12 150 5.57e-30 SMART
Zpr1 184 343 4.27e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121598
AA Change: Q82R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079
AA Change: Q82R

DomainStartEndE-ValueType
Pfam:Apolipoprotein 51 305 8.1e-66 PFAM
low complexity region 312 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125239
SMART Domains Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Blast:Zpr1 33 59 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141763
Predicted Effect probably benign
Transcript: ENSMUST00000156440
SMART Domains Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 416 4.27e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213878
AA Change: Q82R

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000214202
AA Change: Q82R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215187
Predicted Effect probably benign
Transcript: ENSMUST00000215458
AA Change: Q82R

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215484
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apolipoprotein that plays an important role in regulating the plasma triglyceride levels, a major risk factor for coronary artery disease. It is a component of high density lipoprotein and is highly similar to a rat protein that is upregulated in response to liver injury. Mutations in this gene have been associated with hypertriglyceridemia and hyperlipoproteinemia type 5. This gene is located proximal to the apolipoprotein gene cluster on chromosome 11q23. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased triglyceride and VLDL cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 119,904,304 (GRCm39) V264E possibly damaging Het
Abcg1 T A 17: 31,327,408 (GRCm39) W368R probably benign Het
Acin1 A G 14: 54,880,504 (GRCm39) I476T possibly damaging Het
Acsm1 T A 7: 119,239,917 (GRCm39) I287N possibly damaging Het
Adgrv1 C T 13: 81,553,483 (GRCm39) V5464I probably benign Het
AI429214 T A 8: 37,461,545 (GRCm39) L231Q probably damaging Het
Akp3 A G 1: 87,053,556 (GRCm39) probably benign Het
Amy2b C T 3: 113,060,793 (GRCm39) noncoding transcript Het
Arhgap44 A G 11: 64,896,278 (GRCm39) probably null Het
Arhgef38 C A 3: 132,940,442 (GRCm39) G48V probably damaging Het
Bltp3a T A 17: 28,109,079 (GRCm39) F1099L probably benign Het
Bod1l G T 5: 41,975,955 (GRCm39) N1786K probably benign Het
Cav2 A T 6: 17,281,409 (GRCm39) D17V probably null Het
Ccdc148 G T 2: 58,891,900 (GRCm39) N238K probably benign Het
Ccin A T 4: 43,984,981 (GRCm39) I463F probably damaging Het
Cd8b1 C T 6: 71,306,758 (GRCm39) H162Y possibly damaging Het
Cdh16 T A 8: 105,341,858 (GRCm39) probably null Het
Cfap65 T A 1: 74,964,513 (GRCm39) probably benign Het
Clec4n T C 6: 123,209,155 (GRCm39) probably null Het
Cpne7 T A 8: 123,861,314 (GRCm39) *558R probably null Het
Cs A G 10: 128,189,006 (GRCm39) I172V probably benign Het
Cyp2ab1 A T 16: 20,131,822 (GRCm39) L306Q probably damaging Het
D16Ertd472e A T 16: 78,344,814 (GRCm39) V98E probably damaging Het
Dcaf15 A C 8: 84,829,467 (GRCm39) S92A probably damaging Het
Dkk3 T C 7: 111,748,253 (GRCm39) probably null Het
Dnah11 A T 12: 118,156,162 (GRCm39) C163S probably benign Het
Eda2r T A X: 96,385,239 (GRCm39) Q171L probably damaging Het
Eml4 A T 17: 83,758,377 (GRCm39) K397* probably null Het
Eml6 A T 11: 29,755,108 (GRCm39) I889N possibly damaging Het
Etaa1 A T 11: 17,896,964 (GRCm39) D384E possibly damaging Het
Fzr1 T A 10: 81,203,386 (GRCm39) probably null Het
Gm13889 G T 2: 93,786,921 (GRCm39) F61L probably damaging Het
Gm14149 A T 2: 151,072,684 (GRCm39) noncoding transcript Het
Gm5828 T A 1: 16,839,642 (GRCm39) noncoding transcript Het
Gm5866 G A 5: 52,740,262 (GRCm39) noncoding transcript Het
Gp2 T C 7: 119,056,391 (GRCm39) I27M probably benign Het
Gpr83 G A 9: 14,778,279 (GRCm39) probably null Het
Gucd1 T C 10: 75,346,959 (GRCm39) N97S probably benign Het
H2bc27 C T 11: 58,839,797 (GRCm39) P11L probably benign Het
H2-Q7 T A 17: 35,661,735 (GRCm39) V326E possibly damaging Het
Haao A T 17: 84,139,774 (GRCm39) D227E possibly damaging Het
Hipk3 C T 2: 104,264,104 (GRCm39) S819N probably benign Het
Hlcs A G 16: 94,063,557 (GRCm39) V501A probably benign Het
Hmcn1 A G 1: 150,500,301 (GRCm39) Y3964H probably damaging Het
Ifi204 C A 1: 173,587,927 (GRCm39) probably benign Het
Ifi211 A G 1: 173,735,226 (GRCm39) F68L probably benign Het
Ift57 A G 16: 49,582,957 (GRCm39) probably null Het
Ighv5-12-4 A T 12: 113,725,887 (GRCm39) L112* probably null Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Il36a T A 2: 24,114,416 (GRCm39) M97K possibly damaging Het
Itsn2 A G 12: 4,763,197 (GRCm39) *1686W probably null Het
Jkamp G T 12: 72,140,823 (GRCm39) V123F probably damaging Het
Kat7 C A 11: 95,168,424 (GRCm39) V411L probably damaging Het
Kcnj5 A G 9: 32,233,973 (GRCm39) V114A probably benign Het
Krtap5-4 T A 7: 141,857,491 (GRCm39) C54S unknown Het
Lats1 T A 10: 7,581,448 (GRCm39) N744K possibly damaging Het
Lpo T C 11: 87,705,173 (GRCm39) E387G probably damaging Het
Lrba T G 3: 86,644,471 (GRCm39) M388R probably damaging Het
Lrp2 C A 2: 69,297,337 (GRCm39) R3208L probably damaging Het
Mterf1b T A 5: 4,247,176 (GRCm39) C272* probably null Het
Myh15 A T 16: 48,992,421 (GRCm39) R1632* probably null Het
Myo3b T C 2: 70,069,243 (GRCm39) V494A possibly damaging Het
Myo9a T C 9: 59,782,699 (GRCm39) probably null Het
Nelfa T G 5: 34,059,157 (GRCm39) S233R probably benign Het
Nr4a3 A T 4: 48,051,522 (GRCm39) E121V probably damaging Het
Obscn T A 11: 58,933,116 (GRCm39) E5406D probably damaging Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or1j18 T A 2: 36,624,415 (GRCm39) Y27* probably null Het
Or7e177 A C 9: 20,211,919 (GRCm39) H142P probably damaging Het
Oxct2b T C 4: 123,010,926 (GRCm39) L282P probably damaging Het
Pappa G A 4: 65,233,033 (GRCm39) probably null Het
Pcdhb14 A G 18: 37,581,900 (GRCm39) I335M possibly damaging Het
Pcsk1 T A 13: 75,280,354 (GRCm39) D726E probably damaging Het
Pkhd1 T A 1: 20,434,391 (GRCm39) Q2349L possibly damaging Het
Pkhd1l1 G A 15: 44,410,743 (GRCm39) C2750Y probably damaging Het
Ppp2r3d A G 9: 124,476,821 (GRCm38) C26R unknown Het
Prex2 T A 1: 11,136,049 (GRCm39) I74N probably benign Het
Ptgir A G 7: 16,641,071 (GRCm39) D121G probably benign Het
Pwwp3a T A 10: 80,068,848 (GRCm39) C331S probably benign Het
Ralbp1 T C 17: 66,159,686 (GRCm39) S526G probably null Het
Ric8b T C 10: 84,828,001 (GRCm39) Y442H probably damaging Het
Rpap1 C T 2: 119,605,487 (GRCm39) D385N probably benign Het
Sash1 T C 10: 8,601,424 (GRCm39) Y1177C probably damaging Het
Shroom1 T C 11: 53,356,415 (GRCm39) I363T possibly damaging Het
Slc26a9 T C 1: 131,680,876 (GRCm39) L95P probably damaging Het
Slc44a5 A G 3: 153,962,221 (GRCm39) T385A possibly damaging Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Slc7a1 T A 5: 148,289,209 (GRCm39) M13L probably benign Het
Snrpb2 A G 2: 142,912,893 (GRCm39) N172S possibly damaging Het
Spns1 G T 7: 125,973,474 (GRCm39) probably benign Het
Srsf6 T A 2: 162,775,347 (GRCm39) S86R probably benign Het
Stk25 A T 1: 93,553,378 (GRCm39) probably benign Het
Szt2 A T 4: 118,254,866 (GRCm39) C275S probably benign Het
Tcp10b T A 17: 13,292,504 (GRCm39) probably null Het
Tmem248 T A 5: 130,260,615 (GRCm39) L60H probably damaging Het
Trim27 T C 13: 21,367,930 (GRCm39) I182T probably damaging Het
Tspan10 A G 11: 120,335,324 (GRCm39) N145D probably damaging Het
Vps13d A G 4: 144,801,412 (GRCm39) F487S probably damaging Het
Wdr86 A T 5: 24,923,229 (GRCm39) D154E probably benign Het
Wfdc18 C A 11: 83,600,695 (GRCm39) A32D possibly damaging Het
Wrn A T 8: 33,826,019 (GRCm39) probably null Het
Zfp811 C A 17: 33,019,897 (GRCm39) E7* probably null Het
Other mutations in Apoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Apoa5 APN 9 46,181,950 (GRCm39) missense probably damaging 0.98
IGL02089:Apoa5 APN 9 46,180,437 (GRCm39) critical splice donor site probably null
R0046:Apoa5 UTSW 9 46,181,296 (GRCm39) missense probably damaging 1.00
R1722:Apoa5 UTSW 9 46,181,847 (GRCm39) nonsense probably null
R2007:Apoa5 UTSW 9 46,181,665 (GRCm39) missense possibly damaging 0.95
R2356:Apoa5 UTSW 9 46,181,341 (GRCm39) missense probably damaging 0.98
R3739:Apoa5 UTSW 9 46,180,415 (GRCm39) missense probably damaging 1.00
R3835:Apoa5 UTSW 9 46,181,878 (GRCm39) missense probably damaging 1.00
R4364:Apoa5 UTSW 9 46,181,827 (GRCm39) missense probably damaging 1.00
R4760:Apoa5 UTSW 9 46,181,593 (GRCm39) missense probably damaging 0.97
R5160:Apoa5 UTSW 9 46,181,794 (GRCm39) missense probably damaging 0.99
R5523:Apoa5 UTSW 9 46,181,887 (GRCm39) missense possibly damaging 0.79
R5915:Apoa5 UTSW 9 46,180,607 (GRCm39) missense probably damaging 1.00
R6106:Apoa5 UTSW 9 46,181,931 (GRCm39) nonsense probably null
R6849:Apoa5 UTSW 9 46,181,298 (GRCm39) missense probably benign 0.03
R7170:Apoa5 UTSW 9 46,181,437 (GRCm39) missense probably benign 0.00
R9268:Apoa5 UTSW 9 46,181,719 (GRCm39) missense probably benign 0.18
R9403:Apoa5 UTSW 9 46,181,944 (GRCm39) missense probably damaging 1.00
R9495:Apoa5 UTSW 9 46,181,944 (GRCm39) missense probably damaging 1.00
R9499:Apoa5 UTSW 9 46,181,944 (GRCm39) missense probably damaging 1.00
Z1177:Apoa5 UTSW 9 46,180,417 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAATATTAGTGTCCCACAGCTTTGG -3'
(R):5'- AGCTGAGCCTTGGTGTCTTC -3'

Sequencing Primer
(F):5'- CTTTGGGGAAAGGGAGATTTCAATGC -3'
(R):5'- CAGCTCCTGCACACTCAG -3'
Posted On 2015-10-08