Incidental Mutation 'R4657:Pcsk1'

• ID: 352552
• Institutional Source: Beutler Lab
• Gene Symbol: Pcsk1
• Ensembl Gene: ENSMUSG00000021587
• Gene Name: proprotein convertase subtilisin/kexin type 1
• Synonyms: PC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1
• MMRRC Submission: 041917-MU
• Essential gene?: Essential (E-score: 1.000)
• Stock #: R4657 (G1)
• Quality Score: 225
• Status: Validated
• Chromosome: 13
• Chromosomal Location: 75089826-75134861 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to A at 75132235 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Aspartic acid to Glutamic Acid at position 726 (D726E)
• Ref Sequence: ENSEMBL: ENSMUSP00000022075
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000022075]
• AlphaFold: P63239
• PDB Structure: Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR] ; PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR] ; PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]
• Predicted Effect: probably damaging; Transcript: ENSMUST00000022075; AA Change: D726E; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
• SMART Domains: Protein: ENSMUSP00000022075; Gene: ENSMUSG00000021587; AA Change: D726E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:S8_pro-domain	34	110	6.4e-26	PFAM
Pfam:Peptidase_S8	158	442	2.2e-49	PFAM
Pfam:P_proprotein	504	591	6.1e-30	PFAM
low complexity region	679	694	N/A	INTRINSIC
Pfam:Proho_convert	713	751	4.3e-26	PFAM

• Meta Mutation Damage Score: 0.2813
• Coding Region Coverage:
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
• Validation Efficiency: 98% (105/107)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014] ; PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]
• Posted On: 2015-10-08

Predicted Primers

PCR Primer
(F):5'- CTGCGACTCCTACAAAGTGC -3'
(R):5'- ACGAATGATGAAGTTGGCTTTC -3'

Sequencing Primer
(F):5'- GCGACTCCTACAAAGTGCTTTTAG -3'
(R):5'- GAAACTCACTCCAAAGTACAGTTTG -3'