Incidental Mutation 'R4657:Haao'
ID352564
Institutional Source Beutler Lab
Gene Symbol Haao
Ensembl Gene ENSMUSG00000000673
Gene Name3-hydroxyanthranilate 3,4-dioxygenase
Synonyms3HAO, 0610012J07Rik, 0610007K21Rik, 3-HAO, 3-HAOxase
MMRRC Submission 041917-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4657 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location83831356-83846790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83832345 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 227 (D227E)
Ref Sequence ENSEMBL: ENSMUSP00000000687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000687]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000687
AA Change: D227E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000687
Gene: ENSMUSG00000000673
AA Change: D227E

DomainStartEndE-ValueType
Pfam:3-HAO 1 149 1e-78 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 3-Hydroxyanthranilate 3,4-dioxygenase is a monomeric cytosolic protein belonging to the family of intramolecular dioxygenases containing nonheme ferrous iron. It is widely distributed in peripheral organs, such as liver and kidney, and is also present in low amounts in the central nervous system. HAAO catalyzes the synthesis of quinolinic acid (QUIN) from 3-hydroxyanthranilic acid. QUIN is an excitotoxin whose toxicity is mediated by its ability to activate glutamate N-methyl-D-aspartate receptors. Increased cerebral levels of QUIN may participate in the pathogenesis of neurologic and inflammatory disorders. HAAO has been suggested to play a role in disorders associated with altered tissue levels of QUIN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,013,478 V264E possibly damaging Het
Abcg1 T A 17: 31,108,434 W368R probably benign Het
Acin1 A G 14: 54,643,047 I476T possibly damaging Het
Acsm1 T A 7: 119,640,694 I287N possibly damaging Het
Adgrv1 C T 13: 81,405,364 V5464I probably benign Het
AI429214 T A 8: 36,994,391 L231Q probably damaging Het
Akp3 A G 1: 87,125,834 probably benign Het
Amy2b C T 3: 113,153,477 noncoding transcript Het
Apoa5 A G 9: 46,269,872 Q82R probably benign Het
Arhgap44 A G 11: 65,005,452 probably null Het
Arhgef38 C A 3: 133,234,681 G48V probably damaging Het
Bod1l G T 5: 41,818,612 N1786K probably benign Het
Cav2 A T 6: 17,281,410 D17V probably null Het
Ccdc148 G T 2: 59,001,888 N238K probably benign Het
Ccin A T 4: 43,984,981 I463F probably damaging Het
Cd8b1 C T 6: 71,329,774 H162Y possibly damaging Het
Cdh16 T A 8: 104,615,226 probably null Het
Cfap65 T A 1: 74,925,354 probably benign Het
Clec4n T C 6: 123,232,196 probably null Het
Cpne7 T A 8: 123,134,575 *558R probably null Het
Cs A G 10: 128,353,137 I172V probably benign Het
Cyp2ab1 A T 16: 20,313,072 L306Q probably damaging Het
D16Ertd472e A T 16: 78,547,926 V98E probably damaging Het
Dcaf15 A C 8: 84,102,838 S92A probably damaging Het
Dkk3 T C 7: 112,149,046 probably null Het
Dnah11 A T 12: 118,192,427 C163S probably benign Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Eml4 A T 17: 83,450,948 K397* probably null Het
Eml6 A T 11: 29,805,108 I889N possibly damaging Het
Etaa1 A T 11: 17,946,964 D384E possibly damaging Het
Fzr1 T A 10: 81,367,552 probably null Het
Gm13889 G T 2: 93,956,576 F61L probably damaging Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gm5828 T A 1: 16,769,418 noncoding transcript Het
Gm5866 G A 5: 52,582,920 noncoding transcript Het
Gp2 T C 7: 119,457,168 I27M probably benign Het
Gpr83 G A 9: 14,866,983 probably null Het
Gucd1 T C 10: 75,511,125 N97S probably benign Het
H2-Q7 T A 17: 35,442,759 V326E possibly damaging Het
Hipk3 C T 2: 104,433,759 S819N probably benign Het
Hist3h2ba C T 11: 58,948,971 P11L probably benign Het
Hlcs A G 16: 94,262,698 V501A probably benign Het
Hmcn1 A G 1: 150,624,550 Y3964H probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifi211 A G 1: 173,907,660 F68L probably benign Het
Ift57 A G 16: 49,762,594 probably null Het
Ighv5-12-4 A T 12: 113,762,267 L112* probably null Het
Il1f6 T A 2: 24,224,404 M97K possibly damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Itsn2 A G 12: 4,713,197 *1686W probably null Het
Jkamp G T 12: 72,094,049 V123F probably damaging Het
Kat7 C A 11: 95,277,598 V411L probably damaging Het
Kcnj5 A G 9: 32,322,677 V114A probably benign Het
Krtap5-4 T A 7: 142,303,754 C54S unknown Het
Lats1 T A 10: 7,705,684 N744K possibly damaging Het
Lpo T C 11: 87,814,347 E387G probably damaging Het
Lrba T G 3: 86,737,164 M388R probably damaging Het
Lrp2 C A 2: 69,466,993 R3208L probably damaging Het
Mterf1b T A 5: 4,197,176 C272* probably null Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh15 A T 16: 49,172,058 R1632* probably null Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo9a T C 9: 59,875,416 probably null Het
Nelfa T G 5: 33,901,813 S233R probably benign Het
Nr4a3 A T 4: 48,051,522 E121V probably damaging Het
Obscn T A 11: 59,042,290 E5406D probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr347 T A 2: 36,734,403 Y27* probably null Het
Olfr873 A C 9: 20,300,623 H142P probably damaging Het
Oxct2b T C 4: 123,117,133 L282P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb14 A G 18: 37,448,847 I335M possibly damaging Het
Pcsk1 T A 13: 75,132,235 D726E probably damaging Het
Pkhd1 T A 1: 20,364,167 Q2349L possibly damaging Het
Pkhd1l1 G A 15: 44,547,347 C2750Y probably damaging Het
Ppp2r3d A G 9: 124,476,821 C26R unknown Het
Prex2 T A 1: 11,065,825 I74N probably benign Het
Ptgir A G 7: 16,907,146 D121G probably benign Het
Ralbp1 T C 17: 65,852,691 S526G probably null Het
Ric8b T C 10: 84,992,137 Y442H probably damaging Het
Rpap1 C T 2: 119,775,006 D385N probably benign Het
Sash1 T C 10: 8,725,660 Y1177C probably damaging Het
Shroom1 T C 11: 53,465,588 I363T possibly damaging Het
Slc26a9 T C 1: 131,753,138 L95P probably damaging Het
Slc44a5 A G 3: 154,256,584 T385A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc7a1 T A 5: 148,352,399 M13L probably benign Het
Snrpb2 A G 2: 143,070,973 N172S possibly damaging Het
Spns1 G T 7: 126,374,302 probably benign Het
Srsf6 T A 2: 162,933,427 S86R probably benign Het
Stk25 A T 1: 93,625,656 probably benign Het
Szt2 A T 4: 118,397,669 C275S probably benign Het
Tcp10b T A 17: 13,073,617 probably null Het
Tmem248 T A 5: 130,231,774 L60H probably damaging Het
Trim27 T C 13: 21,183,760 I182T probably damaging Het
Tspan10 A G 11: 120,444,498 N145D probably damaging Het
Uhrf1bp1 T A 17: 27,890,105 F1099L probably benign Het
Vps13d A G 4: 145,074,842 F487S probably damaging Het
Wdr86 A T 5: 24,718,231 D154E probably benign Het
Wfdc18 C A 11: 83,709,869 A32D possibly damaging Het
Wrn A T 8: 33,335,991 probably null Het
Zfp811 C A 17: 32,800,923 E7* probably null Het
Other mutations in Haao
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Haao APN 17 83834930 splice site probably benign
IGL01728:Haao APN 17 83835229 missense probably damaging 1.00
IGL02603:Haao APN 17 83835541 missense probably benign 0.45
IGL03328:Haao APN 17 83846649 missense probably damaging 1.00
R0635:Haao UTSW 17 83838574 missense probably damaging 1.00
R1295:Haao UTSW 17 83838838 missense probably benign 0.38
R1296:Haao UTSW 17 83838838 missense probably benign 0.38
R1472:Haao UTSW 17 83838838 missense probably benign 0.38
R1563:Haao UTSW 17 83834889 missense probably benign 0.01
R2424:Haao UTSW 17 83835562 missense probably damaging 0.99
R3917:Haao UTSW 17 83838799 critical splice donor site probably null
R4857:Haao UTSW 17 83838580 critical splice acceptor site probably null
R6475:Haao UTSW 17 83831684 missense possibly damaging 0.87
R6989:Haao UTSW 17 83831674 missense probably damaging 1.00
R7390:Haao UTSW 17 83846652 missense probably damaging 0.99
R8073:Haao UTSW 17 83835220 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATGAGTACATGCATGGTGGG -3'
(R):5'- TCTGATCCCTGACGAGTAGG -3'

Sequencing Primer
(F):5'- GCTCTTATAAGGAGGCCATAAGTTCC -3'
(R):5'- AGTAGGCTCGTCACATGGG -3'
Posted On2015-10-08