Mutagenetix > Incidental Mutation

Incidental Mutation 'R4658:Atrn'

352576

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

041918-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4658 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130933429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 151 (Y151H)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably damaging
Transcript: ENSMUST00000028781
AA Change: Y151H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: Y151H

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134964

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156982

Meta Mutation Damage Score

0.8802

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,200,564	R778S	probably damaging	Het
Adam17	A	G	12: 21,332,160	C567R	probably damaging	Het
Ankrd28	G	A	14: 31,710,868	A758V	probably damaging	Het
B3gat3	A	G	19: 8,925,632	T118A	possibly damaging	Het
Camta1	A	G	4: 151,143,910	C822R	probably damaging	Het
Capn15	G	T	17: 25,960,768	Q807K	probably benign	Het
Clec12a	T	C	6: 129,354,530	Y145H	probably damaging	Het
Clk1	T	C	1: 58,412,987	I393V	probably benign	Het
Cpm	A	G	10: 117,668,051	I121V	probably benign	Het
Cux1	A	G	5: 136,250,594	I405T	possibly damaging	Het
Dnah3	A	G	7: 119,950,651	S3471P	probably damaging	Het
Dok6	A	G	18: 89,473,847		probably benign	Het
Eif4g1	A	T	16: 20,685,934	D1124V	possibly damaging	Het
Eif4g3	A	G	4: 138,206,132	E1756G	probably damaging	Het
Exo5	A	G	4: 120,922,551	V39A	probably benign	Het
Fmnl1	A	T	11: 103,197,694	I90F	probably damaging	Het
Fryl	G	T	5: 73,081,053	T1450K	probably damaging	Het
Gde1	T	C	7: 118,694,528	M91V	probably benign	Het
Gimd1	T	C	3: 132,644,582	I84T	probably damaging	Het
Gm13889	C	T	2: 93,957,108		probably benign	Het
Gm6445	T	A	19: 9,608,197		noncoding transcript	Het
Gm8113	T	C	14: 43,932,410	S483P	probably damaging	Het
Grik2	T	C	10: 49,523,792	I281V	possibly damaging	Het
Grik5	T	C	7: 25,060,727		probably benign	Het
Herc1	A	T	9: 66,479,491	I3796F	possibly damaging	Het
Hoxb13	A	T	11: 96,194,483	D14V	probably benign	Het
Hspg2	A	G	4: 137,533,730	Y1645C	probably damaging	Het
Igkv8-16	G	T	6: 70,386,778	R87S	probably damaging	Het
Ints1	A	T	5: 139,774,299	V140E	possibly damaging	Het
Kbtbd11	C	A	8: 15,028,917	D505E	possibly damaging	Het
Kcnu1	G	A	8: 25,937,555	C300Y	probably damaging	Het
Kmt2d	G	C	15: 98,852,529		probably benign	Het
Lats1	T	C	10: 7,702,729	V539A	probably benign	Het
Lipo5	C	T	19: 33,464,522	G200D	unknown	Het
Lmo7	C	A	14: 101,886,957	A284D	probably damaging	Het
Lyst	G	A	13: 13,635,383	R546H	probably damaging	Het
Mcpt8	T	C	14: 56,083,828	M60V	possibly damaging	Het
Mdn1	A	G	4: 32,730,749		probably null	Het
Mphosph10	A	G	7: 64,388,974		probably null	Het
Muc5b	G	A	7: 141,841,398	S47N	unknown	Het
Notch3	A	T	17: 32,154,763	N490K	probably damaging	Het
Nr1d1	G	A	11: 98,771,912	S85L	possibly damaging	Het
Obscn	T	A	11: 59,054,288	R4635*	probably null	Het
Olfr121	G	T	17: 37,752,163	C103F	probably damaging	Het
Olfr1504	T	C	19: 13,887,548	I221V	probably benign	Het
Olfr275	T	C	4: 52,826,240	L281P	probably damaging	Het
Pappa	G	A	4: 65,314,796		probably null	Het
Pcdhb17	G	A	18: 37,486,599	G481S	probably damaging	Het
Pde1a	TCC	TC	2: 79,898,181		probably benign	Het
Phf3	A	T	1: 30,863,088	M48K	probably damaging	Het
Pira2	A	T	7: 3,840,934	V613E	probably damaging	Het
Poc1a	T	C	9: 106,349,688	S327P	possibly damaging	Het
Ptpn9	A	G	9: 57,020,037	H66R	probably benign	Het
Rabgap1	C	T	2: 37,487,549	R353*	probably null	Het
Rcc1l	G	T	5: 134,171,890	N134K	probably damaging	Het
Rims1	G	A	1: 22,427,543	T787I	probably damaging	Het
Rreb1	T	G	13: 37,948,801	S1651A	probably damaging	Het
Rsl1d1	T	C	16: 11,201,374	D100G	probably damaging	Het
Samd4	C	T	14: 47,064,246	R147C	probably damaging	Het
Serpinb6e	T	C	13: 33,841,316		probably benign	Het
Ska1	T	C	18: 74,197,040	I210V	probably benign	Het
Slc17a1	A	G	13: 23,878,560	I237V	probably benign	Het
Slc22a4	A	T	11: 53,997,510	S231T	probably benign	Het
Slc7a4	T	A	16: 17,575,933	M66L	probably damaging	Het
Snapc1	A	G	12: 73,983,868	T381A	possibly damaging	Het
St6galnac2	C	T	11: 116,684,525		probably benign	Het
Taar2	C	T	10: 23,941,503	L314F	probably benign	Het
Tmem74b	A	G	2: 151,706,641	D96G	probably damaging	Het
Tnfrsf17	T	C	16: 11,313,969	F6S	probably benign	Het
Tpp2	G	T	1: 43,954,710	G252W	probably damaging	Het
Trf	A	G	9: 103,223,608	F209L	probably damaging	Het
Ttn	T	C	2: 76,898,591		probably benign	Het
Uhmk1	A	T	1: 170,207,205	H311Q	probably damaging	Het
Unc13c	G	T	9: 73,932,826	Q248K	probably damaging	Het
Uqcrc2	A	G	7: 120,650,921	Y253C	probably damaging	Het
Vmn2r117	A	G	17: 23,478,416	F101L	probably benign	Het
Vmn2r43	T	C	7: 8,255,071	N381S	probably benign	Het
Zfp879	T	A	11: 50,833,197	Y271F	probably damaging	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAGGCGTGTTCTCCTAGTTG -3'
(R):5'- GAAGTCATAGGTTCAATCCCTATCACC -3'

Sequencing Primer
(F):5'- TCTCCTAGTTGTAGTACATGCTG -3'
(R):5'- AGGAGTCACTCTTCCACTGTGG -3'

Posted On

2015-10-08