Incidental Mutation 'R4658:Acacb'
ID352587
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission 041918-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4658 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114200564 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 778 (R778S)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
Predicted Effect probably damaging
Transcript: ENSMUST00000031583
AA Change: R778S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: R778S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102582
AA Change: R778S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: R778S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Meta Mutation Damage Score 0.1528 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A G 12: 21,332,160 C567R probably damaging Het
Ankrd28 G A 14: 31,710,868 A758V probably damaging Het
Atrn T C 2: 130,933,429 Y151H probably damaging Het
B3gat3 A G 19: 8,925,632 T118A possibly damaging Het
Camta1 A G 4: 151,143,910 C822R probably damaging Het
Capn15 G T 17: 25,960,768 Q807K probably benign Het
Clec12a T C 6: 129,354,530 Y145H probably damaging Het
Clk1 T C 1: 58,412,987 I393V probably benign Het
Cpm A G 10: 117,668,051 I121V probably benign Het
Cux1 A G 5: 136,250,594 I405T possibly damaging Het
Dnah3 A G 7: 119,950,651 S3471P probably damaging Het
Dok6 A G 18: 89,473,847 probably benign Het
Eif4g1 A T 16: 20,685,934 D1124V possibly damaging Het
Eif4g3 A G 4: 138,206,132 E1756G probably damaging Het
Exo5 A G 4: 120,922,551 V39A probably benign Het
Fmnl1 A T 11: 103,197,694 I90F probably damaging Het
Fryl G T 5: 73,081,053 T1450K probably damaging Het
Gde1 T C 7: 118,694,528 M91V probably benign Het
Gimd1 T C 3: 132,644,582 I84T probably damaging Het
Gm13889 C T 2: 93,957,108 probably benign Het
Gm6445 T A 19: 9,608,197 noncoding transcript Het
Gm8113 T C 14: 43,932,410 S483P probably damaging Het
Grik2 T C 10: 49,523,792 I281V possibly damaging Het
Grik5 T C 7: 25,060,727 probably benign Het
Herc1 A T 9: 66,479,491 I3796F possibly damaging Het
Hoxb13 A T 11: 96,194,483 D14V probably benign Het
Hspg2 A G 4: 137,533,730 Y1645C probably damaging Het
Igkv8-16 G T 6: 70,386,778 R87S probably damaging Het
Ints1 A T 5: 139,774,299 V140E possibly damaging Het
Kbtbd11 C A 8: 15,028,917 D505E possibly damaging Het
Kcnu1 G A 8: 25,937,555 C300Y probably damaging Het
Kmt2d G C 15: 98,852,529 probably benign Het
Lats1 T C 10: 7,702,729 V539A probably benign Het
Lipo5 C T 19: 33,464,522 G200D unknown Het
Lmo7 C A 14: 101,886,957 A284D probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcpt8 T C 14: 56,083,828 M60V possibly damaging Het
Mdn1 A G 4: 32,730,749 probably null Het
Mphosph10 A G 7: 64,388,974 probably null Het
Muc5b G A 7: 141,841,398 S47N unknown Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Nr1d1 G A 11: 98,771,912 S85L possibly damaging Het
Obscn T A 11: 59,054,288 R4635* probably null Het
Olfr121 G T 17: 37,752,163 C103F probably damaging Het
Olfr1504 T C 19: 13,887,548 I221V probably benign Het
Olfr275 T C 4: 52,826,240 L281P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb17 G A 18: 37,486,599 G481S probably damaging Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Phf3 A T 1: 30,863,088 M48K probably damaging Het
Pira2 A T 7: 3,840,934 V613E probably damaging Het
Poc1a T C 9: 106,349,688 S327P possibly damaging Het
Ptpn9 A G 9: 57,020,037 H66R probably benign Het
Rabgap1 C T 2: 37,487,549 R353* probably null Het
Rcc1l G T 5: 134,171,890 N134K probably damaging Het
Rims1 G A 1: 22,427,543 T787I probably damaging Het
Rreb1 T G 13: 37,948,801 S1651A probably damaging Het
Rsl1d1 T C 16: 11,201,374 D100G probably damaging Het
Samd4 C T 14: 47,064,246 R147C probably damaging Het
Serpinb6e T C 13: 33,841,316 probably benign Het
Ska1 T C 18: 74,197,040 I210V probably benign Het
Slc17a1 A G 13: 23,878,560 I237V probably benign Het
Slc22a4 A T 11: 53,997,510 S231T probably benign Het
Slc7a4 T A 16: 17,575,933 M66L probably damaging Het
Snapc1 A G 12: 73,983,868 T381A possibly damaging Het
St6galnac2 C T 11: 116,684,525 probably benign Het
Taar2 C T 10: 23,941,503 L314F probably benign Het
Tmem74b A G 2: 151,706,641 D96G probably damaging Het
Tnfrsf17 T C 16: 11,313,969 F6S probably benign Het
Tpp2 G T 1: 43,954,710 G252W probably damaging Het
Trf A G 9: 103,223,608 F209L probably damaging Het
Ttn T C 2: 76,898,591 probably benign Het
Uhmk1 A T 1: 170,207,205 H311Q probably damaging Het
Unc13c G T 9: 73,932,826 Q248K probably damaging Het
Uqcrc2 A G 7: 120,650,921 Y253C probably damaging Het
Vmn2r117 A G 17: 23,478,416 F101L probably benign Het
Vmn2r43 T C 7: 8,255,071 N381S probably benign Het
Zfp879 T A 11: 50,833,197 Y271F probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
acetone UTSW 5 114226857 nonsense probably null
anabolism UTSW 5 114245220 missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense possibly damaging 0.63
BB011:Acacb UTSW 5 114245220 missense possibly damaging 0.63
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7396:Acacb UTSW 5 114213661 missense possibly damaging 0.87
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7484:Acacb UTSW 5 114218862 missense probably damaging 1.00
R7585:Acacb UTSW 5 114246012 missense probably damaging 0.99
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7924:Acacb UTSW 5 114245220 missense possibly damaging 0.63
R7940:Acacb UTSW 5 114166047 missense possibly damaging 0.77
R7951:Acacb UTSW 5 114188340 missense probably damaging 1.00
R7960:Acacb UTSW 5 114230861 missense probably benign 0.00
R7972:Acacb UTSW 5 114226857 nonsense probably null
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
R8678:Acacb UTSW 5 114201971 nonsense probably null
R8693:Acacb UTSW 5 114226783 missense probably damaging 0.99
R8697:Acacb UTSW 5 114213380 missense probably damaging 0.96
R8772:Acacb UTSW 5 114184118 missense possibly damaging 0.73
R8918:Acacb UTSW 5 114195254 missense not run
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACGATATCGACACGGGGTG -3'
(R):5'- ATATCCACCAGTAGTCTCTCCCAG -3'

Sequencing Primer
(F):5'- TGGACCACCTCATCGCTCAG -3'
(R):5'- ACATGCGTGTGATCCCAG -3'
Posted On2015-10-08