Incidental Mutation 'R4658:Rcc1l'
ID352588
Institutional Source Beutler Lab
Gene Symbol Rcc1l
Ensembl Gene ENSMUSG00000061979
Gene Namereculator of chromosome condensation 1 like
SynonymsWbscr16, 5730496C04Rik
MMRRC Submission 041918-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R4658 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134148054-134176774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 134171890 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 134 (N134K)
Ref Sequence ENSEMBL: ENSMUSP00000075581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076228]
Predicted Effect probably damaging
Transcript: ENSMUST00000076228
AA Change: N134K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075581
Gene: ENSMUSG00000061979
AA Change: N134K

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 28 40 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:RCC1 127 186 2.3e-10 PFAM
Pfam:RCC1_2 173 202 1e-9 PFAM
Pfam:RCC1 190 242 5.6e-11 PFAM
Pfam:RCC1_2 229 258 2.9e-12 PFAM
Pfam:RCC1 245 295 5.1e-8 PFAM
Pfam:RCC1 298 348 2e-12 PFAM
Pfam:RCC1_2 391 422 2.6e-9 PFAM
Pfam:RCC1 409 456 3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192921
Meta Mutation Damage Score 0.6658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing regulator of chromosome condensation 1-like repeats. The encoded protein may function as a guanine nucleotide exchange factor. This gene is located in a region of chromosome 7 that is deleted in Williams-Beuren syndrome, a multisystem developmental disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,564 R778S probably damaging Het
Adam17 A G 12: 21,332,160 C567R probably damaging Het
Ankrd28 G A 14: 31,710,868 A758V probably damaging Het
Atrn T C 2: 130,933,429 Y151H probably damaging Het
B3gat3 A G 19: 8,925,632 T118A possibly damaging Het
Camta1 A G 4: 151,143,910 C822R probably damaging Het
Capn15 G T 17: 25,960,768 Q807K probably benign Het
Clec12a T C 6: 129,354,530 Y145H probably damaging Het
Clk1 T C 1: 58,412,987 I393V probably benign Het
Cpm A G 10: 117,668,051 I121V probably benign Het
Cux1 A G 5: 136,250,594 I405T possibly damaging Het
Dnah3 A G 7: 119,950,651 S3471P probably damaging Het
Dok6 A G 18: 89,473,847 probably benign Het
Eif4g1 A T 16: 20,685,934 D1124V possibly damaging Het
Eif4g3 A G 4: 138,206,132 E1756G probably damaging Het
Exo5 A G 4: 120,922,551 V39A probably benign Het
Fmnl1 A T 11: 103,197,694 I90F probably damaging Het
Fryl G T 5: 73,081,053 T1450K probably damaging Het
Gde1 T C 7: 118,694,528 M91V probably benign Het
Gimd1 T C 3: 132,644,582 I84T probably damaging Het
Gm13889 C T 2: 93,957,108 probably benign Het
Gm6445 T A 19: 9,608,197 noncoding transcript Het
Gm8113 T C 14: 43,932,410 S483P probably damaging Het
Grik2 T C 10: 49,523,792 I281V possibly damaging Het
Grik5 T C 7: 25,060,727 probably benign Het
Herc1 A T 9: 66,479,491 I3796F possibly damaging Het
Hoxb13 A T 11: 96,194,483 D14V probably benign Het
Hspg2 A G 4: 137,533,730 Y1645C probably damaging Het
Igkv8-16 G T 6: 70,386,778 R87S probably damaging Het
Ints1 A T 5: 139,774,299 V140E possibly damaging Het
Kbtbd11 C A 8: 15,028,917 D505E possibly damaging Het
Kcnu1 G A 8: 25,937,555 C300Y probably damaging Het
Kmt2d G C 15: 98,852,529 probably benign Het
Lats1 T C 10: 7,702,729 V539A probably benign Het
Lipo5 C T 19: 33,464,522 G200D unknown Het
Lmo7 C A 14: 101,886,957 A284D probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcpt8 T C 14: 56,083,828 M60V possibly damaging Het
Mdn1 A G 4: 32,730,749 probably null Het
Mphosph10 A G 7: 64,388,974 probably null Het
Muc5b G A 7: 141,841,398 S47N unknown Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Nr1d1 G A 11: 98,771,912 S85L possibly damaging Het
Obscn T A 11: 59,054,288 R4635* probably null Het
Olfr121 G T 17: 37,752,163 C103F probably damaging Het
Olfr1504 T C 19: 13,887,548 I221V probably benign Het
Olfr275 T C 4: 52,826,240 L281P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb17 G A 18: 37,486,599 G481S probably damaging Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Phf3 A T 1: 30,863,088 M48K probably damaging Het
Pira2 A T 7: 3,840,934 V613E probably damaging Het
Poc1a T C 9: 106,349,688 S327P possibly damaging Het
Ptpn9 A G 9: 57,020,037 H66R probably benign Het
Rabgap1 C T 2: 37,487,549 R353* probably null Het
Rims1 G A 1: 22,427,543 T787I probably damaging Het
Rreb1 T G 13: 37,948,801 S1651A probably damaging Het
Rsl1d1 T C 16: 11,201,374 D100G probably damaging Het
Samd4 C T 14: 47,064,246 R147C probably damaging Het
Serpinb6e T C 13: 33,841,316 probably benign Het
Ska1 T C 18: 74,197,040 I210V probably benign Het
Slc17a1 A G 13: 23,878,560 I237V probably benign Het
Slc22a4 A T 11: 53,997,510 S231T probably benign Het
Slc7a4 T A 16: 17,575,933 M66L probably damaging Het
Snapc1 A G 12: 73,983,868 T381A possibly damaging Het
St6galnac2 C T 11: 116,684,525 probably benign Het
Taar2 C T 10: 23,941,503 L314F probably benign Het
Tmem74b A G 2: 151,706,641 D96G probably damaging Het
Tnfrsf17 T C 16: 11,313,969 F6S probably benign Het
Tpp2 G T 1: 43,954,710 G252W probably damaging Het
Trf A G 9: 103,223,608 F209L probably damaging Het
Ttn T C 2: 76,898,591 probably benign Het
Uhmk1 A T 1: 170,207,205 H311Q probably damaging Het
Unc13c G T 9: 73,932,826 Q248K probably damaging Het
Uqcrc2 A G 7: 120,650,921 Y253C probably damaging Het
Vmn2r117 A G 17: 23,478,416 F101L probably benign Het
Vmn2r43 T C 7: 8,255,071 N381S probably benign Het
Zfp879 T A 11: 50,833,197 Y271F probably damaging Het
Other mutations in Rcc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0563:Rcc1l UTSW 5 134176555 missense probably benign 0.16
R1834:Rcc1l UTSW 5 134163659 missense probably damaging 1.00
R2108:Rcc1l UTSW 5 134155790 missense probably benign 0.00
R2512:Rcc1l UTSW 5 134166669 missense probably damaging 0.98
R3705:Rcc1l UTSW 5 134154191 missense probably damaging 1.00
R4192:Rcc1l UTSW 5 134155809 missense probably benign
R4791:Rcc1l UTSW 5 134163776 missense possibly damaging 0.89
R6076:Rcc1l UTSW 5 134169328 missense possibly damaging 0.90
R6291:Rcc1l UTSW 5 134166721 splice site probably null
R6508:Rcc1l UTSW 5 134169238 missense probably damaging 1.00
R6799:Rcc1l UTSW 5 134176713 start codon destroyed probably null
R7344:Rcc1l UTSW 5 134176437 missense probably benign 0.03
Z1177:Rcc1l UTSW 5 134163757 missense probably benign 0.10
Z1177:Rcc1l UTSW 5 134165408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCAGAGGCTGACAACAGG -3'
(R):5'- CAGATGATGGCCTACATGTGTG -3'

Sequencing Primer
(F):5'- TAGGCTGGCTTCAAACTCAG -3'
(R):5'- GGCCTACATGTGTGTAAATAGC -3'
Posted On2015-10-08