Incidental Mutation 'R4658:Mphosph10'
ID352596
Institutional Source Beutler Lab
Gene Symbol Mphosph10
Ensembl Gene ENSMUSG00000030521
Gene NameM-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)
Synonyms
MMRRC Submission 041918-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R4658 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64376527-64392268 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 64388974 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032735] [ENSMUST00000037205] [ENSMUST00000206194] [ENSMUST00000206882]
Predicted Effect probably damaging
Transcript: ENSMUST00000032735
AA Change: V275A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032735
Gene: ENSMUSG00000030521
AA Change: V275A

DomainStartEndE-ValueType
Pfam:Mpp10 20 654 6.9e-217 PFAM
low complexity region 666 671 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037205
SMART Domains Protein: ENSMUSP00000047855
Gene: ENSMUSG00000033429

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Glyoxalase 49 175 2.7e-14 PFAM
Pfam:Glyoxalase_3 50 166 5.1e-9 PFAM
Pfam:Glyoxalase_4 51 162 1.2e-20 PFAM
Pfam:Glyoxalase_2 55 175 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126727
AA Change: V430A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206138
Predicted Effect probably null
Transcript: ENSMUST00000206194
Predicted Effect probably null
Transcript: ENSMUST00000206882
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is phosphorylated during mitosis. The protein localizes to the nucleolus during interphase and to the chromosomes during M phase. The protein associates with the U3 small nucleolar ribonucleoprotein 60-80S complexes and may be involved in pre-rRNA processing. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,564 R778S probably damaging Het
Adam17 A G 12: 21,332,160 C567R probably damaging Het
Ankrd28 G A 14: 31,710,868 A758V probably damaging Het
Atrn T C 2: 130,933,429 Y151H probably damaging Het
B3gat3 A G 19: 8,925,632 T118A possibly damaging Het
Camta1 A G 4: 151,143,910 C822R probably damaging Het
Capn15 G T 17: 25,960,768 Q807K probably benign Het
Clec12a T C 6: 129,354,530 Y145H probably damaging Het
Clk1 T C 1: 58,412,987 I393V probably benign Het
Cpm A G 10: 117,668,051 I121V probably benign Het
Cux1 A G 5: 136,250,594 I405T possibly damaging Het
Dnah3 A G 7: 119,950,651 S3471P probably damaging Het
Dok6 A G 18: 89,473,847 probably benign Het
Eif4g1 A T 16: 20,685,934 D1124V possibly damaging Het
Eif4g3 A G 4: 138,206,132 E1756G probably damaging Het
Exo5 A G 4: 120,922,551 V39A probably benign Het
Fmnl1 A T 11: 103,197,694 I90F probably damaging Het
Fryl G T 5: 73,081,053 T1450K probably damaging Het
Gde1 T C 7: 118,694,528 M91V probably benign Het
Gimd1 T C 3: 132,644,582 I84T probably damaging Het
Gm13889 C T 2: 93,957,108 probably benign Het
Gm6445 T A 19: 9,608,197 noncoding transcript Het
Gm8113 T C 14: 43,932,410 S483P probably damaging Het
Grik2 T C 10: 49,523,792 I281V possibly damaging Het
Grik5 T C 7: 25,060,727 probably benign Het
Herc1 A T 9: 66,479,491 I3796F possibly damaging Het
Hoxb13 A T 11: 96,194,483 D14V probably benign Het
Hspg2 A G 4: 137,533,730 Y1645C probably damaging Het
Igkv8-16 G T 6: 70,386,778 R87S probably damaging Het
Ints1 A T 5: 139,774,299 V140E possibly damaging Het
Kbtbd11 C A 8: 15,028,917 D505E possibly damaging Het
Kcnu1 G A 8: 25,937,555 C300Y probably damaging Het
Kmt2d G C 15: 98,852,529 probably benign Het
Lats1 T C 10: 7,702,729 V539A probably benign Het
Lipo5 C T 19: 33,464,522 G200D unknown Het
Lmo7 C A 14: 101,886,957 A284D probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcpt8 T C 14: 56,083,828 M60V possibly damaging Het
Mdn1 A G 4: 32,730,749 probably null Het
Muc5b G A 7: 141,841,398 S47N unknown Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Nr1d1 G A 11: 98,771,912 S85L possibly damaging Het
Obscn T A 11: 59,054,288 R4635* probably null Het
Olfr121 G T 17: 37,752,163 C103F probably damaging Het
Olfr1504 T C 19: 13,887,548 I221V probably benign Het
Olfr275 T C 4: 52,826,240 L281P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb17 G A 18: 37,486,599 G481S probably damaging Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Phf3 A T 1: 30,863,088 M48K probably damaging Het
Pira2 A T 7: 3,840,934 V613E probably damaging Het
Poc1a T C 9: 106,349,688 S327P possibly damaging Het
Ptpn9 A G 9: 57,020,037 H66R probably benign Het
Rabgap1 C T 2: 37,487,549 R353* probably null Het
Rcc1l G T 5: 134,171,890 N134K probably damaging Het
Rims1 G A 1: 22,427,543 T787I probably damaging Het
Rreb1 T G 13: 37,948,801 S1651A probably damaging Het
Rsl1d1 T C 16: 11,201,374 D100G probably damaging Het
Samd4 C T 14: 47,064,246 R147C probably damaging Het
Serpinb6e T C 13: 33,841,316 probably benign Het
Ska1 T C 18: 74,197,040 I210V probably benign Het
Slc17a1 A G 13: 23,878,560 I237V probably benign Het
Slc22a4 A T 11: 53,997,510 S231T probably benign Het
Slc7a4 T A 16: 17,575,933 M66L probably damaging Het
Snapc1 A G 12: 73,983,868 T381A possibly damaging Het
St6galnac2 C T 11: 116,684,525 probably benign Het
Taar2 C T 10: 23,941,503 L314F probably benign Het
Tmem74b A G 2: 151,706,641 D96G probably damaging Het
Tnfrsf17 T C 16: 11,313,969 F6S probably benign Het
Tpp2 G T 1: 43,954,710 G252W probably damaging Het
Trf A G 9: 103,223,608 F209L probably damaging Het
Ttn T C 2: 76,898,591 probably benign Het
Uhmk1 A T 1: 170,207,205 H311Q probably damaging Het
Unc13c G T 9: 73,932,826 Q248K probably damaging Het
Uqcrc2 A G 7: 120,650,921 Y253C probably damaging Het
Vmn2r117 A G 17: 23,478,416 F101L probably benign Het
Vmn2r43 T C 7: 8,255,071 N381S probably benign Het
Zfp879 T A 11: 50,833,197 Y271F probably damaging Het
Other mutations in Mphosph10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mphosph10 APN 7 64389755 missense probably benign 0.00
IGL02113:Mphosph10 APN 7 64376807 unclassified probably benign
IGL02615:Mphosph10 APN 7 64381045 splice site probably benign
R0280:Mphosph10 UTSW 7 64376703 missense possibly damaging 0.92
R0372:Mphosph10 UTSW 7 64388855 unclassified probably benign
R0503:Mphosph10 UTSW 7 64389893 missense probably benign
R0548:Mphosph10 UTSW 7 64378800 missense probably benign 0.45
R1158:Mphosph10 UTSW 7 64388859 unclassified probably benign
R1271:Mphosph10 UTSW 7 64390084 unclassified probably null
R1447:Mphosph10 UTSW 7 64380950 missense probably damaging 1.00
R1501:Mphosph10 UTSW 7 64389504 missense probably damaging 1.00
R1815:Mphosph10 UTSW 7 64392170 missense probably benign 0.05
R1900:Mphosph10 UTSW 7 64381028 missense possibly damaging 0.61
R1997:Mphosph10 UTSW 7 64387447 critical splice donor site probably null
R2058:Mphosph10 UTSW 7 64376751 missense probably damaging 1.00
R2059:Mphosph10 UTSW 7 64376751 missense probably damaging 1.00
R2292:Mphosph10 UTSW 7 64385771 missense probably damaging 1.00
R4817:Mphosph10 UTSW 7 64392221 unclassified probably benign
R4968:Mphosph10 UTSW 7 64382908 missense probably damaging 1.00
R5121:Mphosph10 UTSW 7 64389596 missense probably damaging 1.00
R5187:Mphosph10 UTSW 7 64385820 missense possibly damaging 0.49
R5304:Mphosph10 UTSW 7 64388984 missense probably damaging 1.00
R5469:Mphosph10 UTSW 7 64389445 critical splice donor site probably null
R6179:Mphosph10 UTSW 7 64378781 missense possibly damaging 0.66
R6360:Mphosph10 UTSW 7 64389955 missense probably benign 0.00
R6632:Mphosph10 UTSW 7 64385819 missense probably damaging 1.00
R6996:Mphosph10 UTSW 7 64388921 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTTGTTATGTATCTGACAACCTGAG -3'
(R):5'- TATGGTGGTCAACTAGTTGCCAG -3'

Sequencing Primer
(F):5'- GAGAAATACCTTACAGCTCTGACTGG -3'
(R):5'- GTGGTCAACTAGTTGCCAGTTTCC -3'
Posted On2015-10-08