Incidental Mutation 'R4658:Unc13c'
ID352605
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
MMRRC Submission 041918-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4658 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73932826 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 248 (Q248K)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably damaging
Transcript: ENSMUST00000075245
AA Change: Q248K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: Q248K

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184666
AA Change: Q248K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: Q248K

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Meta Mutation Damage Score 0.1003 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (88/89)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,564 R778S probably damaging Het
Adam17 A G 12: 21,332,160 C567R probably damaging Het
Ankrd28 G A 14: 31,710,868 A758V probably damaging Het
Atrn T C 2: 130,933,429 Y151H probably damaging Het
B3gat3 A G 19: 8,925,632 T118A possibly damaging Het
Camta1 A G 4: 151,143,910 C822R probably damaging Het
Capn15 G T 17: 25,960,768 Q807K probably benign Het
Clec12a T C 6: 129,354,530 Y145H probably damaging Het
Clk1 T C 1: 58,412,987 I393V probably benign Het
Cpm A G 10: 117,668,051 I121V probably benign Het
Cux1 A G 5: 136,250,594 I405T possibly damaging Het
Dnah3 A G 7: 119,950,651 S3471P probably damaging Het
Dok6 A G 18: 89,473,847 probably benign Het
Eif4g1 A T 16: 20,685,934 D1124V possibly damaging Het
Eif4g3 A G 4: 138,206,132 E1756G probably damaging Het
Exo5 A G 4: 120,922,551 V39A probably benign Het
Fmnl1 A T 11: 103,197,694 I90F probably damaging Het
Fryl G T 5: 73,081,053 T1450K probably damaging Het
Gde1 T C 7: 118,694,528 M91V probably benign Het
Gimd1 T C 3: 132,644,582 I84T probably damaging Het
Gm13889 C T 2: 93,957,108 probably benign Het
Gm6445 T A 19: 9,608,197 noncoding transcript Het
Gm8113 T C 14: 43,932,410 S483P probably damaging Het
Grik2 T C 10: 49,523,792 I281V possibly damaging Het
Grik5 T C 7: 25,060,727 probably benign Het
Herc1 A T 9: 66,479,491 I3796F possibly damaging Het
Hoxb13 A T 11: 96,194,483 D14V probably benign Het
Hspg2 A G 4: 137,533,730 Y1645C probably damaging Het
Igkv8-16 G T 6: 70,386,778 R87S probably damaging Het
Ints1 A T 5: 139,774,299 V140E possibly damaging Het
Kbtbd11 C A 8: 15,028,917 D505E possibly damaging Het
Kcnu1 G A 8: 25,937,555 C300Y probably damaging Het
Kmt2d G C 15: 98,852,529 probably benign Het
Lats1 T C 10: 7,702,729 V539A probably benign Het
Lipo5 C T 19: 33,464,522 G200D unknown Het
Lmo7 C A 14: 101,886,957 A284D probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcpt8 T C 14: 56,083,828 M60V possibly damaging Het
Mdn1 A G 4: 32,730,749 probably null Het
Mphosph10 A G 7: 64,388,974 probably null Het
Muc5b G A 7: 141,841,398 S47N unknown Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Nr1d1 G A 11: 98,771,912 S85L possibly damaging Het
Obscn T A 11: 59,054,288 R4635* probably null Het
Olfr121 G T 17: 37,752,163 C103F probably damaging Het
Olfr1504 T C 19: 13,887,548 I221V probably benign Het
Olfr275 T C 4: 52,826,240 L281P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb17 G A 18: 37,486,599 G481S probably damaging Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Phf3 A T 1: 30,863,088 M48K probably damaging Het
Pira2 A T 7: 3,840,934 V613E probably damaging Het
Poc1a T C 9: 106,349,688 S327P possibly damaging Het
Ptpn9 A G 9: 57,020,037 H66R probably benign Het
Rabgap1 C T 2: 37,487,549 R353* probably null Het
Rcc1l G T 5: 134,171,890 N134K probably damaging Het
Rims1 G A 1: 22,427,543 T787I probably damaging Het
Rreb1 T G 13: 37,948,801 S1651A probably damaging Het
Rsl1d1 T C 16: 11,201,374 D100G probably damaging Het
Samd4 C T 14: 47,064,246 R147C probably damaging Het
Serpinb6e T C 13: 33,841,316 probably benign Het
Ska1 T C 18: 74,197,040 I210V probably benign Het
Slc17a1 A G 13: 23,878,560 I237V probably benign Het
Slc22a4 A T 11: 53,997,510 S231T probably benign Het
Slc7a4 T A 16: 17,575,933 M66L probably damaging Het
Snapc1 A G 12: 73,983,868 T381A possibly damaging Het
St6galnac2 C T 11: 116,684,525 probably benign Het
Taar2 C T 10: 23,941,503 L314F probably benign Het
Tmem74b A G 2: 151,706,641 D96G probably damaging Het
Tnfrsf17 T C 16: 11,313,969 F6S probably benign Het
Tpp2 G T 1: 43,954,710 G252W probably damaging Het
Trf A G 9: 103,223,608 F209L probably damaging Het
Ttn T C 2: 76,898,591 probably benign Het
Uhmk1 A T 1: 170,207,205 H311Q probably damaging Het
Uqcrc2 A G 7: 120,650,921 Y253C probably damaging Het
Vmn2r117 A G 17: 23,478,416 F101L probably benign Het
Vmn2r43 T C 7: 8,255,071 N381S probably benign Het
Zfp879 T A 11: 50,833,197 Y271F probably damaging Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7916:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7922:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7952:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R8047:Unc13c UTSW 9 73812354 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCAAGTGTTTAATGTAATCGTGG -3'
(R):5'- ACTGGGTGCTCTACGGAAAC -3'

Sequencing Primer
(F):5'- AATCGTGGATGTCTCGAGTTTCCC -3'
(R):5'- AAGAGCCAAGAGTGCGTCTCC -3'
Posted On2015-10-08