Incidental Mutation 'R4658:Trf'
ID352606
Institutional Source Beutler Lab
Gene Symbol Trf
Ensembl Gene ENSMUSG00000032554
Gene Nametransferrin
SynonymsHP, Tfn
MMRRC Submission 041918-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4658 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103204001-103230444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103223608 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 209 (F209L)
Ref Sequence ENSEMBL: ENSMUSP00000127808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035158] [ENSMUST00000112645] [ENSMUST00000126359] [ENSMUST00000164377] [ENSMUST00000165296] [ENSMUST00000166836] [ENSMUST00000170904]
Predicted Effect probably damaging
Transcript: ENSMUST00000035158
AA Change: F223L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035158
Gene: ENSMUSG00000032554
AA Change: F223L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112503
Predicted Effect probably damaging
Transcript: ENSMUST00000112645
AA Change: F223L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108264
Gene: ENSMUSG00000032554
AA Change: F223L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126359
AA Change: F220L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120472
Gene: ENSMUSG00000032554
AA Change: F220L

DomainStartEndE-ValueType
TR_FER 22 237 2.25e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164377
SMART Domains Protein: ENSMUSP00000128647
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Transferrin 25 72 6.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165296
SMART Domains Protein: ENSMUSP00000129013
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 171 5.58e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166836
AA Change: F209L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127808
Gene: ENSMUSG00000090639
AA Change: F209L

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
TR_FER 25 338 4.98e-175 SMART
TR_FER 346 672 8.64e-193 SMART
Pfam:Arf 758 928 1.5e-15 PFAM
Pfam:SRPRB 769 948 1.4e-73 PFAM
Pfam:MMR_HSR1 773 888 7.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168142
SMART Domains Protein: ENSMUSP00000128609
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
TR_FER 2 249 1.87e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170904
SMART Domains Protein: ENSMUSP00000128390
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
TR_FER 15 275 7.6e-139 SMART
Meta Mutation Damage Score 0.8014 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein with an approximate molecular weight of 76.5 kDa. It is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of this protein is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte/pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit refractory iron-deficient, hypochromic, microcytic anemia with iron-loading in the liver, pancreas, heart and brain. Mutants usually die by two weeks of age. Heterozygotes show minor increases in iron stores. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,564 R778S probably damaging Het
Adam17 A G 12: 21,332,160 C567R probably damaging Het
Ankrd28 G A 14: 31,710,868 A758V probably damaging Het
Atrn T C 2: 130,933,429 Y151H probably damaging Het
B3gat3 A G 19: 8,925,632 T118A possibly damaging Het
Camta1 A G 4: 151,143,910 C822R probably damaging Het
Capn15 G T 17: 25,960,768 Q807K probably benign Het
Clec12a T C 6: 129,354,530 Y145H probably damaging Het
Clk1 T C 1: 58,412,987 I393V probably benign Het
Cpm A G 10: 117,668,051 I121V probably benign Het
Cux1 A G 5: 136,250,594 I405T possibly damaging Het
Dnah3 A G 7: 119,950,651 S3471P probably damaging Het
Dok6 A G 18: 89,473,847 probably benign Het
Eif4g1 A T 16: 20,685,934 D1124V possibly damaging Het
Eif4g3 A G 4: 138,206,132 E1756G probably damaging Het
Exo5 A G 4: 120,922,551 V39A probably benign Het
Fmnl1 A T 11: 103,197,694 I90F probably damaging Het
Fryl G T 5: 73,081,053 T1450K probably damaging Het
Gde1 T C 7: 118,694,528 M91V probably benign Het
Gimd1 T C 3: 132,644,582 I84T probably damaging Het
Gm13889 C T 2: 93,957,108 probably benign Het
Gm6445 T A 19: 9,608,197 noncoding transcript Het
Gm8113 T C 14: 43,932,410 S483P probably damaging Het
Grik2 T C 10: 49,523,792 I281V possibly damaging Het
Grik5 T C 7: 25,060,727 probably benign Het
Herc1 A T 9: 66,479,491 I3796F possibly damaging Het
Hoxb13 A T 11: 96,194,483 D14V probably benign Het
Hspg2 A G 4: 137,533,730 Y1645C probably damaging Het
Igkv8-16 G T 6: 70,386,778 R87S probably damaging Het
Ints1 A T 5: 139,774,299 V140E possibly damaging Het
Kbtbd11 C A 8: 15,028,917 D505E possibly damaging Het
Kcnu1 G A 8: 25,937,555 C300Y probably damaging Het
Kmt2d G C 15: 98,852,529 probably benign Het
Lats1 T C 10: 7,702,729 V539A probably benign Het
Lipo5 C T 19: 33,464,522 G200D unknown Het
Lmo7 C A 14: 101,886,957 A284D probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcpt8 T C 14: 56,083,828 M60V possibly damaging Het
Mdn1 A G 4: 32,730,749 probably null Het
Mphosph10 A G 7: 64,388,974 probably null Het
Muc5b G A 7: 141,841,398 S47N unknown Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Nr1d1 G A 11: 98,771,912 S85L possibly damaging Het
Obscn T A 11: 59,054,288 R4635* probably null Het
Olfr121 G T 17: 37,752,163 C103F probably damaging Het
Olfr1504 T C 19: 13,887,548 I221V probably benign Het
Olfr275 T C 4: 52,826,240 L281P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb17 G A 18: 37,486,599 G481S probably damaging Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Phf3 A T 1: 30,863,088 M48K probably damaging Het
Pira2 A T 7: 3,840,934 V613E probably damaging Het
Poc1a T C 9: 106,349,688 S327P possibly damaging Het
Ptpn9 A G 9: 57,020,037 H66R probably benign Het
Rabgap1 C T 2: 37,487,549 R353* probably null Het
Rcc1l G T 5: 134,171,890 N134K probably damaging Het
Rims1 G A 1: 22,427,543 T787I probably damaging Het
Rreb1 T G 13: 37,948,801 S1651A probably damaging Het
Rsl1d1 T C 16: 11,201,374 D100G probably damaging Het
Samd4 C T 14: 47,064,246 R147C probably damaging Het
Serpinb6e T C 13: 33,841,316 probably benign Het
Ska1 T C 18: 74,197,040 I210V probably benign Het
Slc17a1 A G 13: 23,878,560 I237V probably benign Het
Slc22a4 A T 11: 53,997,510 S231T probably benign Het
Slc7a4 T A 16: 17,575,933 M66L probably damaging Het
Snapc1 A G 12: 73,983,868 T381A possibly damaging Het
St6galnac2 C T 11: 116,684,525 probably benign Het
Taar2 C T 10: 23,941,503 L314F probably benign Het
Tmem74b A G 2: 151,706,641 D96G probably damaging Het
Tnfrsf17 T C 16: 11,313,969 F6S probably benign Het
Tpp2 G T 1: 43,954,710 G252W probably damaging Het
Ttn T C 2: 76,898,591 probably benign Het
Uhmk1 A T 1: 170,207,205 H311Q probably damaging Het
Unc13c G T 9: 73,932,826 Q248K probably damaging Het
Uqcrc2 A G 7: 120,650,921 Y253C probably damaging Het
Vmn2r117 A G 17: 23,478,416 F101L probably benign Het
Vmn2r43 T C 7: 8,255,071 N381S probably benign Het
Zfp879 T A 11: 50,833,197 Y271F probably damaging Het
Other mutations in Trf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Trf APN 9 103220957 missense probably benign 0.00
IGL00424:Trf APN 9 103226936 missense probably damaging 1.00
IGL00793:Trf APN 9 103226143 unclassified probably benign
IGL01139:Trf APN 9 103223604 missense probably damaging 1.00
IGL01658:Trf APN 9 103226856 missense probably benign 0.04
IGL02671:Trf APN 9 103211982 missense probably benign 0.01
IGL02996:Trf APN 9 103220903 missense probably benign 0.01
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0112:Trf UTSW 9 103226956 unclassified probably benign
R0234:Trf UTSW 9 103226879 unclassified probably null
R0234:Trf UTSW 9 103226879 unclassified probably null
R0411:Trf UTSW 9 103217501 missense probably damaging 1.00
R0456:Trf UTSW 9 103226903 missense probably damaging 1.00
R0601:Trf UTSW 9 103222933 critical splice donor site probably null
R1419:Trf UTSW 9 103226108 missense probably damaging 1.00
R1606:Trf UTSW 9 103225136 splice site probably null
R3943:Trf UTSW 9 103222952 missense probably benign 0.00
R4431:Trf UTSW 9 103211876 missense possibly damaging 0.81
R4609:Trf UTSW 9 103211985 missense possibly damaging 0.81
R4830:Trf UTSW 9 103227915 missense probably damaging 0.98
R4925:Trf UTSW 9 103219246 missense probably benign 0.00
R4929:Trf UTSW 9 103227875 intron probably benign
R4931:Trf UTSW 9 103228048 missense probably damaging 0.99
R5139:Trf UTSW 9 103222934 critical splice donor site probably null
R5272:Trf UTSW 9 103227978 missense probably damaging 1.00
R5692:Trf UTSW 9 103226125 missense possibly damaging 0.87
R6227:Trf UTSW 9 103230305 start gained probably benign
R6365:Trf UTSW 9 103222128 missense possibly damaging 0.70
R6928:Trf UTSW 9 103222108 missense possibly damaging 0.56
R7127:Trf UTSW 9 103225127 missense probably benign
R7231:Trf UTSW 9 103225148 missense probably damaging 1.00
R7648:Trf UTSW 9 103227969 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCCATGAATCTTGGTAGAGAC -3'
(R):5'- TGTCAGCCACTTTGGGGTAC -3'

Sequencing Primer
(F):5'- TGAATCTTGGTAGAGACCCCCAAAG -3'
(R):5'- ACTTTGGGGTACGTGAGCACATC -3'
Posted On2015-10-08