Incidental Mutation 'R4658:Poc1a'
ID352607
Institutional Source Beutler Lab
Gene Symbol Poc1a
Ensembl Gene ENSMUSG00000023345
Gene NamePOC1 centriolar protein A
SynonymsWdr51a, 2510040D07Rik
MMRRC Submission 041918-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R4658 (G1)
Quality Score195
Status Validated
Chromosome9
Chromosomal Location106281061-106350521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106349688 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 327 (S327P)
Ref Sequence ENSEMBL: ENSMUSP00000140374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072206] [ENSMUST00000191434] [ENSMUST00000214540] [ENSMUST00000216228] [ENSMUST00000217213]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072206
AA Change: S376P

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072064
Gene: ENSMUSG00000023345
AA Change: S376P

DomainStartEndE-ValueType
WD40 8 47 1.76e-9 SMART
WD40 50 89 5.51e-11 SMART
WD40 92 131 2.45e-8 SMART
WD40 134 173 5.14e-11 SMART
WD40 176 215 5.06e-10 SMART
WD40 218 257 9.97e-9 SMART
WD40 260 299 2.67e-9 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 367 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189325
Predicted Effect possibly damaging
Transcript: ENSMUST00000191434
AA Change: S327P

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140374
Gene: ENSMUSG00000023345
AA Change: S327P

DomainStartEndE-ValueType
WD40 7 46 1.76e-9 SMART
WD40 49 88 5.51e-11 SMART
WD40 91 130 2.45e-8 SMART
WD40 133 172 5.14e-11 SMART
WD40 175 214 5.06e-10 SMART
WD40 217 256 9.97e-9 SMART
WD40 259 298 2.67e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214208
Predicted Effect unknown
Transcript: ENSMUST00000214483
AA Change: S364P
Predicted Effect probably benign
Transcript: ENSMUST00000214540
Predicted Effect possibly damaging
Transcript: ENSMUST00000216228
AA Change: S338P

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect unknown
Transcript: ENSMUST00000216306
AA Change: V373A
Predicted Effect possibly damaging
Transcript: ENSMUST00000217213
AA Change: S338P

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0851 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] POC1 proteins contain an N-terminal WD40 domain and a C-terminal coiled coil domain and are part of centrosomes. They play an important role in basal body and cilia formation. This gene encodes one of the two POC1 proteins found in humans. Mutations in this gene result in short stature, onychodysplasia, facial dysmorphism, and hypotrichosis (SOFT) syndrome. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for this mutation exhibit disproportionate dwarfism and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,564 R778S probably damaging Het
Adam17 A G 12: 21,332,160 C567R probably damaging Het
Ankrd28 G A 14: 31,710,868 A758V probably damaging Het
Atrn T C 2: 130,933,429 Y151H probably damaging Het
B3gat3 A G 19: 8,925,632 T118A possibly damaging Het
Camta1 A G 4: 151,143,910 C822R probably damaging Het
Capn15 G T 17: 25,960,768 Q807K probably benign Het
Clec12a T C 6: 129,354,530 Y145H probably damaging Het
Clk1 T C 1: 58,412,987 I393V probably benign Het
Cpm A G 10: 117,668,051 I121V probably benign Het
Cux1 A G 5: 136,250,594 I405T possibly damaging Het
Dnah3 A G 7: 119,950,651 S3471P probably damaging Het
Dok6 A G 18: 89,473,847 probably benign Het
Eif4g1 A T 16: 20,685,934 D1124V possibly damaging Het
Eif4g3 A G 4: 138,206,132 E1756G probably damaging Het
Exo5 A G 4: 120,922,551 V39A probably benign Het
Fmnl1 A T 11: 103,197,694 I90F probably damaging Het
Fryl G T 5: 73,081,053 T1450K probably damaging Het
Gde1 T C 7: 118,694,528 M91V probably benign Het
Gimd1 T C 3: 132,644,582 I84T probably damaging Het
Gm13889 C T 2: 93,957,108 probably benign Het
Gm6445 T A 19: 9,608,197 noncoding transcript Het
Gm8113 T C 14: 43,932,410 S483P probably damaging Het
Grik2 T C 10: 49,523,792 I281V possibly damaging Het
Grik5 T C 7: 25,060,727 probably benign Het
Herc1 A T 9: 66,479,491 I3796F possibly damaging Het
Hoxb13 A T 11: 96,194,483 D14V probably benign Het
Hspg2 A G 4: 137,533,730 Y1645C probably damaging Het
Igkv8-16 G T 6: 70,386,778 R87S probably damaging Het
Ints1 A T 5: 139,774,299 V140E possibly damaging Het
Kbtbd11 C A 8: 15,028,917 D505E possibly damaging Het
Kcnu1 G A 8: 25,937,555 C300Y probably damaging Het
Kmt2d G C 15: 98,852,529 probably benign Het
Lats1 T C 10: 7,702,729 V539A probably benign Het
Lipo5 C T 19: 33,464,522 G200D unknown Het
Lmo7 C A 14: 101,886,957 A284D probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcpt8 T C 14: 56,083,828 M60V possibly damaging Het
Mdn1 A G 4: 32,730,749 probably null Het
Mphosph10 A G 7: 64,388,974 probably null Het
Muc5b G A 7: 141,841,398 S47N unknown Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Nr1d1 G A 11: 98,771,912 S85L possibly damaging Het
Obscn T A 11: 59,054,288 R4635* probably null Het
Olfr121 G T 17: 37,752,163 C103F probably damaging Het
Olfr1504 T C 19: 13,887,548 I221V probably benign Het
Olfr275 T C 4: 52,826,240 L281P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb17 G A 18: 37,486,599 G481S probably damaging Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Phf3 A T 1: 30,863,088 M48K probably damaging Het
Pira2 A T 7: 3,840,934 V613E probably damaging Het
Ptpn9 A G 9: 57,020,037 H66R probably benign Het
Rabgap1 C T 2: 37,487,549 R353* probably null Het
Rcc1l G T 5: 134,171,890 N134K probably damaging Het
Rims1 G A 1: 22,427,543 T787I probably damaging Het
Rreb1 T G 13: 37,948,801 S1651A probably damaging Het
Rsl1d1 T C 16: 11,201,374 D100G probably damaging Het
Samd4 C T 14: 47,064,246 R147C probably damaging Het
Serpinb6e T C 13: 33,841,316 probably benign Het
Ska1 T C 18: 74,197,040 I210V probably benign Het
Slc17a1 A G 13: 23,878,560 I237V probably benign Het
Slc22a4 A T 11: 53,997,510 S231T probably benign Het
Slc7a4 T A 16: 17,575,933 M66L probably damaging Het
Snapc1 A G 12: 73,983,868 T381A possibly damaging Het
St6galnac2 C T 11: 116,684,525 probably benign Het
Taar2 C T 10: 23,941,503 L314F probably benign Het
Tmem74b A G 2: 151,706,641 D96G probably damaging Het
Tnfrsf17 T C 16: 11,313,969 F6S probably benign Het
Tpp2 G T 1: 43,954,710 G252W probably damaging Het
Trf A G 9: 103,223,608 F209L probably damaging Het
Ttn T C 2: 76,898,591 probably benign Het
Uhmk1 A T 1: 170,207,205 H311Q probably damaging Het
Unc13c G T 9: 73,932,826 Q248K probably damaging Het
Uqcrc2 A G 7: 120,650,921 Y253C probably damaging Het
Vmn2r117 A G 17: 23,478,416 F101L probably benign Het
Vmn2r43 T C 7: 8,255,071 N381S probably benign Het
Zfp879 T A 11: 50,833,197 Y271F probably damaging Het
Other mutations in Poc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Poc1a APN 9 106305304 missense probably benign 0.27
IGL02792:Poc1a APN 9 106295194 missense possibly damaging 0.75
IGL02936:Poc1a APN 9 106285027 missense probably damaging 1.00
PIT4305001:Poc1a UTSW 9 106349829 missense
R2154:Poc1a UTSW 9 106285574 critical splice donor site probably null
R4811:Poc1a UTSW 9 106349709 missense probably damaging 0.96
R5058:Poc1a UTSW 9 106349813 utr 3 prime probably benign
R5059:Poc1a UTSW 9 106349813 utr 3 prime probably benign
R5060:Poc1a UTSW 9 106349813 utr 3 prime probably benign
R5461:Poc1a UTSW 9 106288010 missense probably damaging 1.00
R7592:Poc1a UTSW 9 106349768 missense probably benign 0.28
R8680:Poc1a UTSW 9 106349761 missense probably benign
RF009:Poc1a UTSW 9 106295218 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGAGGCTATGAGATCTGTCCTC -3'
(R):5'- AGATGTGGCTCTCTCAGGTG -3'

Sequencing Primer
(F):5'- GGCTATGAGATCTGTCCTCTGTCTTC -3'
(R):5'- CAGGTGGGATCCCTTTATTTATTTAC -3'
Posted On2015-10-08