Incidental Mutation 'R4658:Lyst'
ID 352621
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Name lysosomal trafficking regulator
Synonyms D13Sfk13
MMRRC Submission 041918-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.395) question?
Stock # R4658 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 13764982-13953388 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 13809968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 546 (R546H)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110559
AA Change: R546H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: R546H

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223527
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,338,625 (GRCm39) R778S probably damaging Het
Adam17 A G 12: 21,382,161 (GRCm39) C567R probably damaging Het
Ankrd28 G A 14: 31,432,825 (GRCm39) A758V probably damaging Het
Atrn T C 2: 130,775,349 (GRCm39) Y151H probably damaging Het
B3gat3 A G 19: 8,902,996 (GRCm39) T118A possibly damaging Het
Camta1 A G 4: 151,228,367 (GRCm39) C822R probably damaging Het
Capn15 G T 17: 26,179,742 (GRCm39) Q807K probably benign Het
Clec12a T C 6: 129,331,493 (GRCm39) Y145H probably damaging Het
Clk1 T C 1: 58,452,146 (GRCm39) I393V probably benign Het
Cpm A G 10: 117,503,956 (GRCm39) I121V probably benign Het
Cux1 A G 5: 136,279,448 (GRCm39) I405T possibly damaging Het
Dnah3 A G 7: 119,549,874 (GRCm39) S3471P probably damaging Het
Dok6 A G 18: 89,491,971 (GRCm39) probably benign Het
Eif4g1 A T 16: 20,504,684 (GRCm39) D1124V possibly damaging Het
Eif4g3 A G 4: 137,933,443 (GRCm39) E1756G probably damaging Het
Exo5 A G 4: 120,779,748 (GRCm39) V39A probably benign Het
Fmnl1 A T 11: 103,088,520 (GRCm39) I90F probably damaging Het
Fryl G T 5: 73,238,396 (GRCm39) T1450K probably damaging Het
Gde1 T C 7: 118,293,751 (GRCm39) M91V probably benign Het
Gimd1 T C 3: 132,350,343 (GRCm39) I84T probably damaging Het
Gm13889 C T 2: 93,787,453 (GRCm39) probably benign Het
Gm6445 T A 19: 9,585,561 (GRCm39) noncoding transcript Het
Gm8113 T C 14: 44,169,867 (GRCm39) S483P probably damaging Het
Grik2 T C 10: 49,399,888 (GRCm39) I281V possibly damaging Het
Grik5 T C 7: 24,760,152 (GRCm39) probably benign Het
Herc1 A T 9: 66,386,773 (GRCm39) I3796F possibly damaging Het
Hoxb13 A T 11: 96,085,309 (GRCm39) D14V probably benign Het
Hspg2 A G 4: 137,261,041 (GRCm39) Y1645C probably damaging Het
Igkv8-16 G T 6: 70,363,762 (GRCm39) R87S probably damaging Het
Ints1 A T 5: 139,760,054 (GRCm39) V140E possibly damaging Het
Kbtbd11 C A 8: 15,078,917 (GRCm39) D505E possibly damaging Het
Kcnu1 G A 8: 26,427,583 (GRCm39) C300Y probably damaging Het
Kmt2d G C 15: 98,750,410 (GRCm39) probably benign Het
Lats1 T C 10: 7,578,493 (GRCm39) V539A probably benign Het
Lipo5 C T 19: 33,441,922 (GRCm39) G200D unknown Het
Lmo7 C A 14: 102,124,393 (GRCm39) A284D probably damaging Het
Mcpt8 T C 14: 56,321,285 (GRCm39) M60V possibly damaging Het
Mdn1 A G 4: 32,730,749 (GRCm39) probably null Het
Mphosph10 A G 7: 64,038,722 (GRCm39) probably null Het
Muc5b G A 7: 141,395,135 (GRCm39) S47N unknown Het
Notch3 A T 17: 32,373,737 (GRCm39) N490K probably damaging Het
Nr1d1 G A 11: 98,662,738 (GRCm39) S85L possibly damaging Het
Obscn T A 11: 58,945,114 (GRCm39) R4635* probably null Het
Or10al5 G T 17: 38,063,054 (GRCm39) C103F probably damaging Het
Or13f5 T C 4: 52,826,240 (GRCm39) L281P probably damaging Het
Or9i16 T C 19: 13,864,912 (GRCm39) I221V probably benign Het
Pappa G A 4: 65,233,033 (GRCm39) probably null Het
Pcdhb17 G A 18: 37,619,652 (GRCm39) G481S probably damaging Het
Pde1a TCC TC 2: 79,728,525 (GRCm39) probably benign Het
Phf3 A T 1: 30,902,169 (GRCm39) M48K probably damaging Het
Pira2 A T 7: 3,843,933 (GRCm39) V613E probably damaging Het
Poc1a T C 9: 106,226,887 (GRCm39) S327P possibly damaging Het
Ptpn9 A G 9: 56,927,321 (GRCm39) H66R probably benign Het
Rabgap1 C T 2: 37,377,561 (GRCm39) R353* probably null Het
Rcc1l G T 5: 134,200,729 (GRCm39) N134K probably damaging Het
Rims1 G A 1: 22,497,793 (GRCm39) T787I probably damaging Het
Rreb1 T G 13: 38,132,777 (GRCm39) S1651A probably damaging Het
Rsl1d1 T C 16: 11,019,238 (GRCm39) D100G probably damaging Het
Samd4 C T 14: 47,301,703 (GRCm39) R147C probably damaging Het
Serpinb6e T C 13: 34,025,299 (GRCm39) probably benign Het
Ska1 T C 18: 74,330,111 (GRCm39) I210V probably benign Het
Slc17a1 A G 13: 24,062,543 (GRCm39) I237V probably benign Het
Slc22a4 A T 11: 53,888,336 (GRCm39) S231T probably benign Het
Slc7a4 T A 16: 17,393,797 (GRCm39) M66L probably damaging Het
Snapc1 A G 12: 74,030,642 (GRCm39) T381A possibly damaging Het
St6galnac2 C T 11: 116,575,351 (GRCm39) probably benign Het
Taar2 C T 10: 23,817,401 (GRCm39) L314F probably benign Het
Tmem74b A G 2: 151,548,561 (GRCm39) D96G probably damaging Het
Tnfrsf17 T C 16: 11,131,833 (GRCm39) F6S probably benign Het
Tpp2 G T 1: 43,993,870 (GRCm39) G252W probably damaging Het
Trf A G 9: 103,100,807 (GRCm39) F209L probably damaging Het
Ttn T C 2: 76,728,935 (GRCm39) probably benign Het
Uhmk1 A T 1: 170,034,774 (GRCm39) H311Q probably damaging Het
Unc13c G T 9: 73,840,108 (GRCm39) Q248K probably damaging Het
Uqcrc2 A G 7: 120,250,144 (GRCm39) Y253C probably damaging Het
Vmn2r117 A G 17: 23,697,390 (GRCm39) F101L probably benign Het
Vmn2r43 T C 7: 8,258,070 (GRCm39) N381S probably benign Het
Zfp879 T A 11: 50,724,024 (GRCm39) Y271F probably damaging Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13,823,463 (GRCm39) missense probably benign
IGL00474:Lyst APN 13 13,818,121 (GRCm39) missense possibly damaging 0.48
IGL00484:Lyst APN 13 13,884,188 (GRCm39) missense probably benign 0.02
IGL00492:Lyst APN 13 13,852,760 (GRCm39) missense possibly damaging 0.54
IGL00807:Lyst APN 13 13,825,008 (GRCm39) missense possibly damaging 0.91
IGL00949:Lyst APN 13 13,810,070 (GRCm39) missense possibly damaging 0.87
IGL00952:Lyst APN 13 13,852,692 (GRCm39) missense probably benign 0.05
IGL01305:Lyst APN 13 13,852,641 (GRCm39) missense probably benign 0.01
IGL01317:Lyst APN 13 13,845,455 (GRCm39) missense probably benign
IGL01419:Lyst APN 13 13,810,423 (GRCm39) missense probably benign 0.00
IGL01445:Lyst APN 13 13,826,299 (GRCm39) missense probably benign 0.00
IGL01690:Lyst APN 13 13,917,831 (GRCm39) missense probably damaging 1.00
IGL01791:Lyst APN 13 13,809,887 (GRCm39) missense probably damaging 1.00
IGL01809:Lyst APN 13 13,812,388 (GRCm39) missense probably damaging 1.00
IGL01896:Lyst APN 13 13,810,162 (GRCm39) missense probably benign 0.04
IGL01938:Lyst APN 13 13,812,009 (GRCm39) missense possibly damaging 0.93
IGL01986:Lyst APN 13 13,950,212 (GRCm39) critical splice donor site probably null
IGL02022:Lyst APN 13 13,838,629 (GRCm39) nonsense probably null
IGL02044:Lyst APN 13 13,887,431 (GRCm39) missense probably damaging 1.00
IGL02157:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02185:Lyst APN 13 13,835,678 (GRCm39) nonsense probably null
IGL02215:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02245:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02246:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02247:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02297:Lyst APN 13 13,812,677 (GRCm39) nonsense probably null
IGL02411:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02415:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02419:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02420:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02429:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02501:Lyst APN 13 13,886,230 (GRCm39) missense probably benign 0.02
IGL02522:Lyst APN 13 13,809,290 (GRCm39) missense possibly damaging 0.81
IGL02535:Lyst APN 13 13,824,927 (GRCm39) missense probably benign 0.00
IGL02596:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02601:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02603:Lyst APN 13 13,835,541 (GRCm39) missense probably benign
IGL02608:Lyst APN 13 13,887,339 (GRCm39) missense probably damaging 0.98
IGL02622:Lyst APN 13 13,855,975 (GRCm39) missense probably damaging 1.00
IGL02690:Lyst APN 13 13,815,710 (GRCm39) missense possibly damaging 0.58
IGL02715:Lyst APN 13 13,848,905 (GRCm39) splice site probably null
IGL02725:Lyst APN 13 13,935,412 (GRCm39) missense probably damaging 1.00
IGL02729:Lyst APN 13 13,921,194 (GRCm39) missense possibly damaging 0.95
IGL02729:Lyst APN 13 13,848,924 (GRCm39) missense possibly damaging 0.81
IGL02820:Lyst APN 13 13,812,643 (GRCm39) missense probably benign 0.03
IGL02945:Lyst APN 13 13,935,783 (GRCm39) missense possibly damaging 0.48
IGL02981:Lyst APN 13 13,809,496 (GRCm39) missense probably damaging 0.99
IGL03087:Lyst APN 13 13,809,641 (GRCm39) missense probably damaging 1.00
IGL03149:Lyst APN 13 13,856,029 (GRCm39) missense probably benign 0.14
IGL03158:Lyst APN 13 13,826,337 (GRCm39) critical splice donor site probably null
IGL03226:Lyst APN 13 13,884,144 (GRCm39) missense probably benign 0.01
IGL03242:Lyst APN 13 13,831,466 (GRCm39) nonsense probably null
IGL03385:Lyst APN 13 13,831,565 (GRCm39) nonsense probably null
50-cal UTSW 13 13,882,797 (GRCm39) critical splice donor site probably null
charcoal UTSW 13 13,871,346 (GRCm39) nonsense probably null
charlotte_gray UTSW 13 13,602,026 (GRCm38) intron probably benign
charzard UTSW 13 13,821,668 (GRCm39) nonsense probably null
grey_wolf UTSW 13 0 () unclassified
lightspeed UTSW 13 13,915,121 (GRCm39) missense possibly damaging 0.91
pardon UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
robin UTSW 13 13,823,387 (GRCm39) nonsense probably null
sooty UTSW 13 0 () unclassified
souris UTSW 13 13,857,808 (GRCm39) unclassified probably benign
Swallow UTSW 13 13,932,007 (GRCm39) missense probably benign 0.00
vulpix UTSW 13 13,871,379 (GRCm39) splice site probably null
ANU22:Lyst UTSW 13 13,852,641 (GRCm39) missense probably benign 0.01
IGL02835:Lyst UTSW 13 13,835,685 (GRCm39) missense possibly damaging 0.82
P0031:Lyst UTSW 13 13,838,616 (GRCm39) missense probably damaging 1.00
R0012:Lyst UTSW 13 13,862,279 (GRCm39) missense probably benign 0.10
R0012:Lyst UTSW 13 13,862,279 (GRCm39) missense probably benign 0.10
R0031:Lyst UTSW 13 13,882,741 (GRCm39) missense probably benign 0.14
R0115:Lyst UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
R0212:Lyst UTSW 13 13,810,570 (GRCm39) missense possibly damaging 0.93
R0386:Lyst UTSW 13 13,882,799 (GRCm39) splice site probably benign
R0393:Lyst UTSW 13 13,821,664 (GRCm39) missense probably benign 0.01
R0415:Lyst UTSW 13 13,886,195 (GRCm39) splice site probably benign
R0446:Lyst UTSW 13 13,812,633 (GRCm39) missense probably benign 0.00
R0481:Lyst UTSW 13 13,852,537 (GRCm39) missense probably benign 0.00
R0499:Lyst UTSW 13 13,791,298 (GRCm39) missense probably damaging 1.00
R0506:Lyst UTSW 13 13,812,600 (GRCm39) missense probably benign
R0530:Lyst UTSW 13 13,931,891 (GRCm39) splice site probably benign
R0541:Lyst UTSW 13 13,855,878 (GRCm39) missense probably benign 0.00
R0570:Lyst UTSW 13 13,883,971 (GRCm39) missense probably benign 0.26
R0680:Lyst UTSW 13 13,824,926 (GRCm39) missense probably benign 0.01
R0842:Lyst UTSW 13 13,852,826 (GRCm39) nonsense probably null
R0848:Lyst UTSW 13 13,809,515 (GRCm39) missense probably benign 0.00
R1014:Lyst UTSW 13 13,808,645 (GRCm39) missense possibly damaging 0.49
R1205:Lyst UTSW 13 13,854,787 (GRCm39) missense probably benign
R1251:Lyst UTSW 13 13,809,068 (GRCm39) missense probably benign 0.00
R1304:Lyst UTSW 13 13,926,569 (GRCm39) nonsense probably null
R1398:Lyst UTSW 13 13,915,121 (GRCm39) missense possibly damaging 0.91
R1445:Lyst UTSW 13 13,814,639 (GRCm39) missense possibly damaging 0.94
R1475:Lyst UTSW 13 13,882,797 (GRCm39) critical splice donor site probably null
R1479:Lyst UTSW 13 13,809,067 (GRCm39) missense probably benign 0.00
R1484:Lyst UTSW 13 13,852,775 (GRCm39) missense probably benign 0.01
R1498:Lyst UTSW 13 13,824,960 (GRCm39) missense possibly damaging 0.49
R1540:Lyst UTSW 13 13,809,686 (GRCm39) missense possibly damaging 0.81
R1611:Lyst UTSW 13 13,809,482 (GRCm39) missense probably damaging 0.97
R1653:Lyst UTSW 13 13,809,811 (GRCm39) missense probably damaging 1.00
R1669:Lyst UTSW 13 13,818,672 (GRCm39) missense possibly damaging 0.90
R1686:Lyst UTSW 13 13,809,290 (GRCm39) missense possibly damaging 0.81
R1694:Lyst UTSW 13 13,835,746 (GRCm39) missense probably damaging 0.98
R1747:Lyst UTSW 13 13,932,007 (GRCm39) missense probably benign 0.00
R1793:Lyst UTSW 13 13,821,668 (GRCm39) nonsense probably null
R1871:Lyst UTSW 13 13,826,297 (GRCm39) missense probably benign 0.00
R1905:Lyst UTSW 13 13,808,719 (GRCm39) missense probably benign
R1958:Lyst UTSW 13 13,791,203 (GRCm39) missense probably damaging 1.00
R1969:Lyst UTSW 13 13,904,929 (GRCm39) missense probably damaging 0.99
R2040:Lyst UTSW 13 13,815,807 (GRCm39) missense probably benign 0.00
R2109:Lyst UTSW 13 13,887,405 (GRCm39) missense possibly damaging 0.46
R2116:Lyst UTSW 13 13,810,286 (GRCm39) missense probably damaging 0.99
R2121:Lyst UTSW 13 13,835,556 (GRCm39) missense probably damaging 1.00
R2127:Lyst UTSW 13 13,809,847 (GRCm39) missense probably damaging 1.00
R2187:Lyst UTSW 13 13,883,926 (GRCm39) missense possibly damaging 0.61
R2238:Lyst UTSW 13 13,917,848 (GRCm39) missense probably benign 0.41
R2258:Lyst UTSW 13 13,812,243 (GRCm39) missense probably benign 0.00
R2292:Lyst UTSW 13 13,915,080 (GRCm39) missense probably damaging 1.00
R2368:Lyst UTSW 13 13,871,248 (GRCm39) missense probably damaging 0.96
R2908:Lyst UTSW 13 13,844,458 (GRCm39) missense probably benign 0.03
R3001:Lyst UTSW 13 13,871,290 (GRCm39) missense probably benign
R3002:Lyst UTSW 13 13,871,290 (GRCm39) missense probably benign
R3024:Lyst UTSW 13 13,833,272 (GRCm39) missense probably benign
R3113:Lyst UTSW 13 13,844,512 (GRCm39) missense probably benign 0.12
R3406:Lyst UTSW 13 13,809,815 (GRCm39) missense possibly damaging 0.56
R3972:Lyst UTSW 13 13,881,210 (GRCm39) missense possibly damaging 0.67
R3978:Lyst UTSW 13 13,808,753 (GRCm39) missense possibly damaging 0.82
R4032:Lyst UTSW 13 13,791,250 (GRCm39) missense probably damaging 1.00
R4192:Lyst UTSW 13 13,915,098 (GRCm39) missense probably damaging 1.00
R4206:Lyst UTSW 13 13,810,574 (GRCm39) missense probably benign 0.03
R4298:Lyst UTSW 13 13,809,472 (GRCm39) missense probably damaging 1.00
R4344:Lyst UTSW 13 13,873,051 (GRCm39) missense probably benign 0.06
R4441:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4445:Lyst UTSW 13 13,884,149 (GRCm39) missense probably benign 0.42
R4477:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4493:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4494:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4495:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4622:Lyst UTSW 13 13,848,983 (GRCm39) missense probably benign 0.01
R4638:Lyst UTSW 13 13,871,379 (GRCm39) splice site probably null
R4675:Lyst UTSW 13 13,809,968 (GRCm39) missense probably damaging 1.00
R4719:Lyst UTSW 13 13,824,935 (GRCm39) missense probably benign
R4729:Lyst UTSW 13 13,812,486 (GRCm39) missense probably damaging 1.00
R4774:Lyst UTSW 13 13,915,182 (GRCm39) missense probably damaging 1.00
R4811:Lyst UTSW 13 13,951,685 (GRCm39) missense probably benign 0.33
R4877:Lyst UTSW 13 13,857,734 (GRCm39) missense probably damaging 1.00
R4920:Lyst UTSW 13 13,821,645 (GRCm39) missense possibly damaging 0.79
R4933:Lyst UTSW 13 13,933,963 (GRCm39) missense probably benign 0.12
R4933:Lyst UTSW 13 13,812,349 (GRCm39) missense probably damaging 0.98
R4958:Lyst UTSW 13 13,810,048 (GRCm39) missense probably benign 0.00
R4982:Lyst UTSW 13 13,900,539 (GRCm39) missense probably damaging 1.00
R4992:Lyst UTSW 13 13,835,748 (GRCm39) missense probably damaging 1.00
R5024:Lyst UTSW 13 13,808,989 (GRCm39) missense probably benign
R5049:Lyst UTSW 13 13,810,649 (GRCm39) missense probably damaging 1.00
R5079:Lyst UTSW 13 13,931,938 (GRCm39) missense probably benign 0.08
R5254:Lyst UTSW 13 13,857,655 (GRCm39) missense probably benign 0.00
R5266:Lyst UTSW 13 13,835,555 (GRCm39) missense probably damaging 1.00
R5279:Lyst UTSW 13 13,823,387 (GRCm39) nonsense probably null
R5285:Lyst UTSW 13 13,809,011 (GRCm39) missense probably benign 0.01
R5364:Lyst UTSW 13 13,831,439 (GRCm39) missense probably benign 0.35
R5435:Lyst UTSW 13 13,951,649 (GRCm39) missense possibly damaging 0.64
R5516:Lyst UTSW 13 13,818,707 (GRCm39) missense probably benign 0.10
R5524:Lyst UTSW 13 13,921,364 (GRCm39) missense probably benign 0.03
R5591:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5592:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5593:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5594:Lyst UTSW 13 13,917,918 (GRCm39) missense probably damaging 0.99
R5594:Lyst UTSW 13 13,933,982 (GRCm39) missense probably benign 0.00
R5644:Lyst UTSW 13 13,812,081 (GRCm39) missense possibly damaging 0.58
R5659:Lyst UTSW 13 13,809,212 (GRCm39) missense possibly damaging 0.58
R5741:Lyst UTSW 13 13,808,615 (GRCm39) missense probably benign 0.44
R5908:Lyst UTSW 13 13,871,346 (GRCm39) nonsense probably null
R5969:Lyst UTSW 13 13,862,398 (GRCm39) splice site probably null
R6128:Lyst UTSW 13 13,933,964 (GRCm39) missense possibly damaging 0.67
R6271:Lyst UTSW 13 13,833,339 (GRCm39) missense probably benign 0.30
R6315:Lyst UTSW 13 13,818,089 (GRCm39) missense probably benign
R6318:Lyst UTSW 13 13,917,896 (GRCm39) missense possibly damaging 0.88
R6555:Lyst UTSW 13 13,823,510 (GRCm39) missense probably benign 0.01
R6663:Lyst UTSW 13 13,838,701 (GRCm39) splice site probably null
R6701:Lyst UTSW 13 13,856,070 (GRCm39) missense probably benign 0.06
R6711:Lyst UTSW 13 13,809,820 (GRCm39) missense possibly damaging 0.80
R6909:Lyst UTSW 13 13,917,960 (GRCm39) missense probably damaging 1.00
R6915:Lyst UTSW 13 13,900,629 (GRCm39) missense probably benign 0.01
R6929:Lyst UTSW 13 13,917,909 (GRCm39) missense probably damaging 1.00
R6960:Lyst UTSW 13 13,808,663 (GRCm39) missense probably benign 0.12
R7018:Lyst UTSW 13 13,918,044 (GRCm39) critical splice donor site probably null
R7037:Lyst UTSW 13 13,791,251 (GRCm39) missense probably damaging 1.00
R7045:Lyst UTSW 13 13,812,293 (GRCm39) missense probably damaging 1.00
R7045:Lyst UTSW 13 13,809,485 (GRCm39) missense probably benign 0.34
R7070:Lyst UTSW 13 13,932,029 (GRCm39) missense probably benign 0.23
R7188:Lyst UTSW 13 13,926,675 (GRCm39) missense possibly damaging 0.66
R7201:Lyst UTSW 13 13,883,885 (GRCm39) nonsense probably null
R7210:Lyst UTSW 13 13,831,568 (GRCm39) missense probably damaging 1.00
R7229:Lyst UTSW 13 13,818,094 (GRCm39) missense probably benign 0.00
R7293:Lyst UTSW 13 13,854,822 (GRCm39) missense probably benign 0.01
R7318:Lyst UTSW 13 13,932,028 (GRCm39) missense probably benign 0.13
R7344:Lyst UTSW 13 13,881,140 (GRCm39) missense probably benign
R7426:Lyst UTSW 13 13,812,109 (GRCm39) missense probably benign
R7522:Lyst UTSW 13 13,821,668 (GRCm39) nonsense probably null
R7583:Lyst UTSW 13 13,810,472 (GRCm39) missense probably damaging 1.00
R7606:Lyst UTSW 13 13,812,060 (GRCm39) missense probably damaging 1.00
R7636:Lyst UTSW 13 13,791,332 (GRCm39) critical splice donor site probably null
R7658:Lyst UTSW 13 13,905,061 (GRCm39) missense possibly damaging 0.63
R7685:Lyst UTSW 13 13,844,450 (GRCm39) missense probably benign 0.00
R7689:Lyst UTSW 13 13,857,808 (GRCm39) critical splice donor site probably null
R7765:Lyst UTSW 13 13,884,117 (GRCm39) missense possibly damaging 0.75
R7779:Lyst UTSW 13 13,809,128 (GRCm39) missense probably damaging 1.00
R7871:Lyst UTSW 13 13,810,637 (GRCm39) nonsense probably null
R7872:Lyst UTSW 13 13,810,450 (GRCm39) missense probably benign 0.14
R7884:Lyst UTSW 13 13,882,268 (GRCm39) missense probably benign 0.09
R7890:Lyst UTSW 13 13,915,154 (GRCm39) missense probably damaging 0.99
R7916:Lyst UTSW 13 13,821,657 (GRCm39) missense possibly damaging 0.64
R7948:Lyst UTSW 13 13,921,174 (GRCm39) missense possibly damaging 0.59
R7956:Lyst UTSW 13 13,815,788 (GRCm39) missense possibly damaging 0.80
R8048:Lyst UTSW 13 13,862,230 (GRCm39) missense probably benign 0.12
R8085:Lyst UTSW 13 13,808,894 (GRCm39) missense probably damaging 0.98
R8165:Lyst UTSW 13 13,872,945 (GRCm39) missense probably damaging 0.99
R8235:Lyst UTSW 13 13,935,323 (GRCm39) missense possibly damaging 0.69
R8237:Lyst UTSW 13 13,826,317 (GRCm39) missense probably benign 0.00
R8275:Lyst UTSW 13 13,950,667 (GRCm39) missense probably benign 0.02
R8300:Lyst UTSW 13 13,838,643 (GRCm39) missense possibly damaging 0.79
R8350:Lyst UTSW 13 13,824,973 (GRCm39) nonsense probably null
R8526:Lyst UTSW 13 13,935,391 (GRCm39) missense probably damaging 0.99
R8551:Lyst UTSW 13 13,808,645 (GRCm39) missense possibly damaging 0.77
R8723:Lyst UTSW 13 13,887,342 (GRCm39) missense possibly damaging 0.89
R8772:Lyst UTSW 13 13,812,077 (GRCm39) nonsense probably null
R8778:Lyst UTSW 13 13,903,152 (GRCm39) missense possibly damaging 0.89
R8778:Lyst UTSW 13 13,810,361 (GRCm39) missense possibly damaging 0.89
R8801:Lyst UTSW 13 13,835,595 (GRCm39) missense probably benign 0.10
R8837:Lyst UTSW 13 13,852,548 (GRCm39) missense probably benign
R8874:Lyst UTSW 13 13,812,147 (GRCm39) missense probably benign
R8878:Lyst UTSW 13 13,815,661 (GRCm39) missense probably benign 0.00
R8891:Lyst UTSW 13 13,887,435 (GRCm39) missense possibly damaging 0.67
R9077:Lyst UTSW 13 13,857,693 (GRCm39) missense probably benign 0.02
R9127:Lyst UTSW 13 13,808,827 (GRCm39) missense probably damaging 1.00
R9143:Lyst UTSW 13 13,835,750 (GRCm39) missense probably damaging 0.98
R9216:Lyst UTSW 13 13,823,188 (GRCm39) missense probably benign
R9217:Lyst UTSW 13 13,871,245 (GRCm39) missense probably benign 0.01
R9291:Lyst UTSW 13 13,883,938 (GRCm39) missense probably benign 0.01
R9302:Lyst UTSW 13 13,904,947 (GRCm39) missense possibly damaging 0.46
R9370:Lyst UTSW 13 13,935,333 (GRCm39) missense probably damaging 1.00
R9402:Lyst UTSW 13 13,812,463 (GRCm39) missense probably benign
R9457:Lyst UTSW 13 13,862,330 (GRCm39) missense possibly damaging 0.83
R9481:Lyst UTSW 13 13,857,653 (GRCm39) missense possibly damaging 0.68
R9563:Lyst UTSW 13 13,812,408 (GRCm39) missense probably benign 0.36
R9623:Lyst UTSW 13 13,852,587 (GRCm39) missense probably benign
R9661:Lyst UTSW 13 13,808,779 (GRCm39) missense probably benign 0.01
R9682:Lyst UTSW 13 13,831,526 (GRCm39) missense probably benign 0.21
R9743:Lyst UTSW 13 13,809,323 (GRCm39) missense possibly damaging 0.67
R9801:Lyst UTSW 13 13,809,290 (GRCm39) missense probably damaging 0.97
RF001:Lyst UTSW 13 13,810,426 (GRCm39) missense probably benign
RF002:Lyst UTSW 13 13,808,948 (GRCm39) missense probably benign 0.05
X0024:Lyst UTSW 13 13,809,033 (GRCm39) missense probably benign 0.00
X0026:Lyst UTSW 13 13,926,555 (GRCm39) missense probably damaging 0.99
Z1088:Lyst UTSW 13 13,918,018 (GRCm39) missense probably benign 0.09
Z1176:Lyst UTSW 13 13,951,664 (GRCm39) missense probably benign 0.27
Z1176:Lyst UTSW 13 13,814,692 (GRCm39) missense probably damaging 1.00
Z1177:Lyst UTSW 13 13,854,719 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGCAGAACATTTGAAAGCTCTG -3'
(R):5'- AAGCTTTCAGTGCTGGCAAC -3'

Sequencing Primer
(F):5'- GGTGAAATCAGAGCAACTTCATC -3'
(R):5'- TCAGTGCTGGCAACTTAAAAGC -3'
Posted On 2015-10-08