Incidental Mutation 'R4658:Notch3'
ID352639
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
MMRRC Submission 041918-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4658 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32154763 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 490 (N490K)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect probably damaging
Transcript: ENSMUST00000087723
AA Change: N490K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: N490K

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Meta Mutation Damage Score 0.8503 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,564 R778S probably damaging Het
Adam17 A G 12: 21,332,160 C567R probably damaging Het
Ankrd28 G A 14: 31,710,868 A758V probably damaging Het
Atrn T C 2: 130,933,429 Y151H probably damaging Het
B3gat3 A G 19: 8,925,632 T118A possibly damaging Het
Camta1 A G 4: 151,143,910 C822R probably damaging Het
Capn15 G T 17: 25,960,768 Q807K probably benign Het
Clec12a T C 6: 129,354,530 Y145H probably damaging Het
Clk1 T C 1: 58,412,987 I393V probably benign Het
Cpm A G 10: 117,668,051 I121V probably benign Het
Cux1 A G 5: 136,250,594 I405T possibly damaging Het
Dnah3 A G 7: 119,950,651 S3471P probably damaging Het
Dok6 A G 18: 89,473,847 probably benign Het
Eif4g1 A T 16: 20,685,934 D1124V possibly damaging Het
Eif4g3 A G 4: 138,206,132 E1756G probably damaging Het
Exo5 A G 4: 120,922,551 V39A probably benign Het
Fmnl1 A T 11: 103,197,694 I90F probably damaging Het
Fryl G T 5: 73,081,053 T1450K probably damaging Het
Gde1 T C 7: 118,694,528 M91V probably benign Het
Gimd1 T C 3: 132,644,582 I84T probably damaging Het
Gm13889 C T 2: 93,957,108 probably benign Het
Gm6445 T A 19: 9,608,197 noncoding transcript Het
Gm8113 T C 14: 43,932,410 S483P probably damaging Het
Grik2 T C 10: 49,523,792 I281V possibly damaging Het
Grik5 T C 7: 25,060,727 probably benign Het
Herc1 A T 9: 66,479,491 I3796F possibly damaging Het
Hoxb13 A T 11: 96,194,483 D14V probably benign Het
Hspg2 A G 4: 137,533,730 Y1645C probably damaging Het
Igkv8-16 G T 6: 70,386,778 R87S probably damaging Het
Ints1 A T 5: 139,774,299 V140E possibly damaging Het
Kbtbd11 C A 8: 15,028,917 D505E possibly damaging Het
Kcnu1 G A 8: 25,937,555 C300Y probably damaging Het
Kmt2d G C 15: 98,852,529 probably benign Het
Lats1 T C 10: 7,702,729 V539A probably benign Het
Lipo5 C T 19: 33,464,522 G200D unknown Het
Lmo7 C A 14: 101,886,957 A284D probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcpt8 T C 14: 56,083,828 M60V possibly damaging Het
Mdn1 A G 4: 32,730,749 probably null Het
Mphosph10 A G 7: 64,388,974 probably null Het
Muc5b G A 7: 141,841,398 S47N unknown Het
Nr1d1 G A 11: 98,771,912 S85L possibly damaging Het
Obscn T A 11: 59,054,288 R4635* probably null Het
Olfr121 G T 17: 37,752,163 C103F probably damaging Het
Olfr1504 T C 19: 13,887,548 I221V probably benign Het
Olfr275 T C 4: 52,826,240 L281P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb17 G A 18: 37,486,599 G481S probably damaging Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Phf3 A T 1: 30,863,088 M48K probably damaging Het
Pira2 A T 7: 3,840,934 V613E probably damaging Het
Poc1a T C 9: 106,349,688 S327P possibly damaging Het
Ptpn9 A G 9: 57,020,037 H66R probably benign Het
Rabgap1 C T 2: 37,487,549 R353* probably null Het
Rcc1l G T 5: 134,171,890 N134K probably damaging Het
Rims1 G A 1: 22,427,543 T787I probably damaging Het
Rreb1 T G 13: 37,948,801 S1651A probably damaging Het
Rsl1d1 T C 16: 11,201,374 D100G probably damaging Het
Samd4 C T 14: 47,064,246 R147C probably damaging Het
Serpinb6e T C 13: 33,841,316 probably benign Het
Ska1 T C 18: 74,197,040 I210V probably benign Het
Slc17a1 A G 13: 23,878,560 I237V probably benign Het
Slc22a4 A T 11: 53,997,510 S231T probably benign Het
Slc7a4 T A 16: 17,575,933 M66L probably damaging Het
Snapc1 A G 12: 73,983,868 T381A possibly damaging Het
St6galnac2 C T 11: 116,684,525 probably benign Het
Taar2 C T 10: 23,941,503 L314F probably benign Het
Tmem74b A G 2: 151,706,641 D96G probably damaging Het
Tnfrsf17 T C 16: 11,313,969 F6S probably benign Het
Tpp2 G T 1: 43,954,710 G252W probably damaging Het
Trf A G 9: 103,223,608 F209L probably damaging Het
Ttn T C 2: 76,898,591 probably benign Het
Uhmk1 A T 1: 170,207,205 H311Q probably damaging Het
Unc13c G T 9: 73,932,826 Q248K probably damaging Het
Uqcrc2 A G 7: 120,650,921 Y253C probably damaging Het
Vmn2r117 A G 17: 23,478,416 F101L probably benign Het
Vmn2r43 T C 7: 8,255,071 N381S probably benign Het
Zfp879 T A 11: 50,833,197 Y271F probably damaging Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
Lopressor UTSW 17 32153884 missense probably damaging 1.00
marginal UTSW 17 32164224 missense probably benign
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 intron probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
R7575:Notch3 UTSW 17 32154819 missense possibly damaging 0.81
R7632:Notch3 UTSW 17 32158506 missense probably benign
R7633:Notch3 UTSW 17 32158622 missense probably benign 0.17
R7860:Notch3 UTSW 17 32122773 missense possibly damaging 0.67
R7943:Notch3 UTSW 17 32122773 missense possibly damaging 0.67
R8052:Notch3 UTSW 17 32146571 missense probably damaging 1.00
R8250:Notch3 UTSW 17 32132336 missense probably damaging 1.00
R8296:Notch3 UTSW 17 32122739 missense probably damaging 1.00
R8306:Notch3 UTSW 17 32158112 missense probably damaging 0.99
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Z1176:Notch3 UTSW 17 32141516 missense probably benign 0.12
Z1176:Notch3 UTSW 17 32151370 missense probably damaging 1.00
Z1177:Notch3 UTSW 17 32166694 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGCCTGCCTTATTTGAGTG -3'
(R):5'- GGGTCCAGCTTGTTTGAAAC -3'

Sequencing Primer
(F):5'- AAGCTTGACCACCTGAGTTC -3'
(R):5'- ATCTAAGCCTGAAAGTGTCGTGC -3'
Posted On2015-10-08