Incidental Mutation 'R4659:Notch1'
ID352650
Institutional Source Beutler Lab
Gene Symbol Notch1
Ensembl Gene ENSMUSG00000026923
Gene Namenotch 1
SynonymsTan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1
MMRRC Submission 041919-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4659 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26457903-26516663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26470889 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1148 (E1148G)
Ref Sequence ENSEMBL: ENSMUSP00000028288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]
PDB Structure
The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028288
AA Change: E1148G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: E1148G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 23 58 1.63e1 SMART
EGF 62 99 4.29e-5 SMART
EGF 105 139 6.25e-7 SMART
EGF_CA 140 176 1.02e-6 SMART
EGF_CA 178 216 4.21e-13 SMART
EGF 221 255 6.7e-7 SMART
EGF_CA 257 293 6.8e-8 SMART
EGF_CA 295 333 1.16e-10 SMART
EGF_CA 335 371 3.17e-8 SMART
EGF 375 410 5.32e-1 SMART
EGF_CA 412 450 4.59e-14 SMART
EGF_CA 452 488 1.02e-11 SMART
EGF_CA 490 526 4.81e-8 SMART
EGF_CA 528 564 3.19e-13 SMART
EGF_CA 566 601 1.91e-11 SMART
EGF_CA 603 639 1.78e-11 SMART
EGF_CA 641 676 9.62e-8 SMART
EGF_CA 678 714 2.38e-12 SMART
EGF_CA 716 751 5.23e-9 SMART
EGF_CA 753 789 6.25e-7 SMART
EGF_CA 791 827 1.1e-11 SMART
EGF 832 867 2.03e-6 SMART
EGF_CA 869 905 5.73e-15 SMART
EGF_CA 907 943 4.56e-9 SMART
EGF_CA 945 981 1.64e-10 SMART
EGF_CA 983 1019 5.83e-7 SMART
EGF_CA 1021 1057 1.05e-13 SMART
EGF 1062 1095 8.12e-6 SMART
EGF 1100 1143 5.66e-5 SMART
EGF_CA 1145 1181 1.1e-11 SMART
EGF_CA 1183 1219 3.87e-12 SMART
EGF_CA 1221 1265 2.89e-11 SMART
EGF_CA 1267 1305 1.2e-8 SMART
EGF 1310 1346 5.74e-6 SMART
EGF 1351 1384 4.1e-2 SMART
EGF 1390 1426 2.66e-1 SMART
NL 1442 1480 4.08e-16 SMART
NL 1483 1522 1.08e-15 SMART
NL 1523 1562 7.39e-14 SMART
NOD 1566 1622 1.81e-32 SMART
NODP 1660 1722 3.27e-30 SMART
low complexity region 1729 1746 N/A INTRINSIC
ANK 1870 1912 1.07e2 SMART
ANK 1917 1946 4.82e-3 SMART
ANK 1950 1980 6.71e-2 SMART
ANK 1984 2013 1.23e0 SMART
ANK 2017 2046 9.13e-4 SMART
ANK 2050 2079 2.97e-3 SMART
low complexity region 2205 2222 N/A INTRINSIC
low complexity region 2364 2395 N/A INTRINSIC
DUF3454 2453 2517 2.01e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129506
Predicted Effect probably benign
Transcript: ENSMUST00000132820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183922
Meta Mutation Damage Score 0.2378 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,216,276 probably benign Het
Abcc9 C A 6: 142,672,595 probably null Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Mx1 T C 16: 97,455,239 probably null Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Myt1l A G 12: 29,849,457 N153D probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Nwd1 T A 8: 72,695,321 D998E probably benign Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pitrm1 T A 13: 6,553,182 S88R probably benign Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Sec24c G T 14: 20,683,144 G180C probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Thsd1 C A 8: 22,259,298 Y667* probably null Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Ttll3 A G 6: 113,414,141 I896V probably benign Het
Txnip T G 3: 96,559,427 F190C probably damaging Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in Notch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Notch1 APN 2 26460046 missense probably damaging 0.98
IGL01343:Notch1 APN 2 26472905 missense probably benign 0.25
IGL02066:Notch1 APN 2 26460396 missense possibly damaging 0.71
IGL02158:Notch1 APN 2 26460339 missense probably damaging 1.00
IGL02541:Notch1 APN 2 26468503 missense probably benign 0.12
IGL03280:Notch1 APN 2 26477874 intron probably benign
IGL03338:Notch1 APN 2 26459959 missense probably benign
Antero UTSW 2 26476114 missense possibly damaging 0.96
march UTSW 2 26469899 missense probably damaging 0.98
PIT4494001:Notch1 UTSW 2 26466473 missense probably damaging 1.00
R0013:Notch1 UTSW 2 26473818 missense possibly damaging 0.64
R0025:Notch1 UTSW 2 26470931 missense probably damaging 1.00
R0129:Notch1 UTSW 2 26460458 missense probably benign 0.06
R0285:Notch1 UTSW 2 26460861 missense possibly damaging 0.88
R0531:Notch1 UTSW 2 26466572 missense probably benign 0.00
R0747:Notch1 UTSW 2 26472140 missense unknown
R1440:Notch1 UTSW 2 26480964 intron probably benign
R1502:Notch1 UTSW 2 26484323 missense possibly damaging 0.95
R1539:Notch1 UTSW 2 26472113 nonsense probably null
R1623:Notch1 UTSW 2 26478612 missense possibly damaging 0.88
R1844:Notch1 UTSW 2 26460434 missense probably benign 0.12
R1863:Notch1 UTSW 2 26469950 missense probably damaging 1.00
R1874:Notch1 UTSW 2 26481579 missense possibly damaging 0.89
R1926:Notch1 UTSW 2 26481657 missense probably damaging 1.00
R2156:Notch1 UTSW 2 26460861 missense possibly damaging 0.91
R2196:Notch1 UTSW 2 26463804 nonsense probably null
R2209:Notch1 UTSW 2 26460007 missense probably benign
R2382:Notch1 UTSW 2 26473781 missense probably benign 0.40
R2508:Notch1 UTSW 2 26465473 missense possibly damaging 0.80
R2873:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R2874:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R3798:Notch1 UTSW 2 26478618 missense probably benign 0.00
R4019:Notch1 UTSW 2 26481142 missense probably benign 0.03
R4305:Notch1 UTSW 2 26477924 missense probably damaging 1.00
R4334:Notch1 UTSW 2 26460036 missense probably benign 0.22
R4504:Notch1 UTSW 2 26472177 missense probably benign 0.16
R4624:Notch1 UTSW 2 26478081 missense possibly damaging 0.94
R4703:Notch1 UTSW 2 26471158 missense probably benign
R4869:Notch1 UTSW 2 26471179 missense probably benign 0.21
R4938:Notch1 UTSW 2 26474124 nonsense probably null
R4989:Notch1 UTSW 2 26481181 missense probably damaging 1.00
R5010:Notch1 UTSW 2 26476114 missense possibly damaging 0.96
R5283:Notch1 UTSW 2 26468626 missense probably damaging 1.00
R5303:Notch1 UTSW 2 26478619 missense probably benign 0.01
R5635:Notch1 UTSW 2 26476161 missense probably damaging 1.00
R5755:Notch1 UTSW 2 26473692 missense probably benign 0.12
R5926:Notch1 UTSW 2 26476104 missense probably benign 0.35
R5947:Notch1 UTSW 2 26462528 intron probably benign
R6053:Notch1 UTSW 2 26472912 missense probably benign 0.06
R6161:Notch1 UTSW 2 26468731 missense probably damaging 1.00
R6162:Notch1 UTSW 2 26462195 missense probably benign
R6174:Notch1 UTSW 2 26485442 missense possibly damaging 0.50
R6199:Notch1 UTSW 2 26469899 missense probably damaging 0.98
R6209:Notch1 UTSW 2 26472805 missense probably damaging 1.00
R6251:Notch1 UTSW 2 26474170 missense possibly damaging 0.64
R6493:Notch1 UTSW 2 26472098 missense unknown
R6723:Notch1 UTSW 2 26478106 missense probably damaging 1.00
R6736:Notch1 UTSW 2 26460286 missense probably benign 0.01
R7020:Notch1 UTSW 2 26481574 missense possibly damaging 0.95
R7058:Notch1 UTSW 2 26463818 missense probably benign 0.05
R7154:Notch1 UTSW 2 26459938 missense probably benign
R7291:Notch1 UTSW 2 26476375 missense probably benign 0.01
R7379:Notch1 UTSW 2 26479467 missense probably damaging 1.00
R7560:Notch1 UTSW 2 26460165 missense probably benign 0.43
R7610:Notch1 UTSW 2 26478179 missense probably benign 0.13
R7833:Notch1 UTSW 2 26459533 makesense probably null
R7916:Notch1 UTSW 2 26459533 makesense probably null
X0018:Notch1 UTSW 2 26462227 nonsense probably null
X0066:Notch1 UTSW 2 26470335 missense possibly damaging 0.90
Z1088:Notch1 UTSW 2 26477115 missense probably damaging 0.99
Z1177:Notch1 UTSW 2 26460309 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GTGCTCAGTCTGCCATGATG -3'
(R):5'- TTGCTCAGGCTCAGCTTAG -3'

Sequencing Primer
(F):5'- AGTCTGCCATGATGCACTAG -3'
(R):5'- TGACAATGGGCAGTAGTCCC -3'
Posted On2015-10-08