Incidental Mutation 'R4659:Txnip'
ID352658
Institutional Source Beutler Lab
Gene Symbol Txnip
Ensembl Gene ENSMUSG00000038393
Gene Namethioredoxin interacting protein
SynonymsTHIF, VDUP1, mVDUP1, Hyplip1
MMRRC Submission 041919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4659 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96557957-96561883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 96559427 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 190 (F190C)
Ref Sequence ENSEMBL: ENSMUSP00000102710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049093] [ENSMUST00000074519]
Predicted Effect probably damaging
Transcript: ENSMUST00000049093
AA Change: F189C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041467
Gene: ENSMUSG00000038393
AA Change: F189C

DomainStartEndE-ValueType
Pfam:Arrestin_N 10 152 6.8e-26 PFAM
Arrestin_C 174 301 6.4e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074519
AA Change: F190C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102710
Gene: ENSMUSG00000038393
AA Change: F190C

DomainStartEndE-ValueType
Pfam:Arrestin_N 10 153 1.1e-25 PFAM
Arrestin_C 175 302 6.4e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196871
Meta Mutation Damage Score 0.6045 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a thioredoxin-binding protein that is a member of the alpha arrestin protein family. Thioredoxin is a thiol-oxidoreductase that is a major regulator of cellular redox signaling which protects cells from oxidative stress. This protein inhibits the antioxidative function of thioredoxin resulting in the accumulation of reactive oxygen species and cellular stress. This protein also functions as a regulator of cellular metabolism and of endoplasmic reticulum (ER) stress. This protein may also function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display impaired natural killer cell development and activity, hyperplasia of lymphoid tissue in the ileum, and increased T cell proliferation. Lipid metabolism and blood clotting were also affected by another null mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,216,276 probably benign Het
Abcc9 C A 6: 142,672,595 probably null Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Mx1 T C 16: 97,455,239 probably null Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Myt1l A G 12: 29,849,457 N153D probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Notch1 T C 2: 26,470,889 E1148G probably damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Nwd1 T A 8: 72,695,321 D998E probably benign Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pitrm1 T A 13: 6,553,182 S88R probably benign Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Sec24c G T 14: 20,683,144 G180C probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Thsd1 C A 8: 22,259,298 Y667* probably null Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Ttll3 A G 6: 113,414,141 I896V probably benign Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in Txnip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02297:Txnip APN 3 96558357 missense probably damaging 1.00
IGL02953:Txnip APN 3 96558366 missense probably damaging 0.97
IGL03066:Txnip APN 3 96559618 missense probably damaging 0.97
P0029:Txnip UTSW 3 96560363 splice site probably null
R0336:Txnip UTSW 3 96559979 missense probably benign 0.00
R1604:Txnip UTSW 3 96558961 missense probably benign 0.18
R1988:Txnip UTSW 3 96559750 missense possibly damaging 0.50
R4603:Txnip UTSW 3 96558288 missense probably benign
R4845:Txnip UTSW 3 96559600 missense probably benign 0.36
R6787:Txnip UTSW 3 96560307 missense probably damaging 1.00
R6992:Txnip UTSW 3 96559123 missense possibly damaging 0.47
R7241:Txnip UTSW 3 96559675 missense probably damaging 1.00
R7488:Txnip UTSW 3 96560223 missense probably benign 0.05
R7663:Txnip UTSW 3 96559837 missense possibly damaging 0.82
X0050:Txnip UTSW 3 96559778 missense probably damaging 1.00
X0057:Txnip UTSW 3 96558965 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGATGTCAATACCCCTGACC -3'
(R):5'- CATGGATGGAGATGTCATCACC -3'

Sequencing Primer
(F):5'- GGATGTCAATACCCCTGACCTAATGG -3'
(R):5'- TGGATGGAGATGTCATCACCTAGAG -3'
Posted On2015-10-08