Incidental Mutation 'R0270:Vmn1r228'
ID 35266
Institutional Source Beutler Lab
Gene Symbol Vmn1r228
Ensembl Gene ENSMUSG00000060245
Gene Name vomeronasal 1 receptor 228
Synonyms V1re3
MMRRC Submission 038496-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R0270 (G1)
Quality Score 207
Status Validated
Chromosome 17
Chromosomal Location 20996321-20997763 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 20996858 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 220 (V220G)
Ref Sequence ENSEMBL: ENSMUSP00000072243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072410]
AlphaFold Q8R2A7
Predicted Effect possibly damaging
Transcript: ENSMUST00000072410
AA Change: V220G

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072243
Gene: ENSMUSG00000060245
AA Change: V220G

DomainStartEndE-ValueType
Pfam:TAS2R 32 317 2.6e-11 PFAM
Pfam:7tm_1 53 316 2.6e-9 PFAM
Pfam:V1R 63 321 1.3e-26 PFAM
Meta Mutation Damage Score 0.4059 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 96.0%
  • 20x: 93.2%
Validation Efficiency 99% (113/114)
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,093,906 (GRCm39) probably benign Het
Aadacl2fm3 T A 3: 59,784,440 (GRCm39) N304K probably benign Het
Abcf3 T A 16: 20,378,918 (GRCm39) probably null Het
Acadm C T 3: 153,641,961 (GRCm39) M190I possibly damaging Het
Adamtsl3 G A 7: 82,206,032 (GRCm39) R739Q probably damaging Het
Ank1 T A 8: 23,578,941 (GRCm39) probably benign Het
Ap3b1 T A 13: 94,540,626 (GRCm39) probably benign Het
Arhgdib A G 6: 136,903,732 (GRCm39) V31A probably damaging Het
Arid4a A G 12: 71,119,406 (GRCm39) R342G probably damaging Het
Asic3 C T 5: 24,622,700 (GRCm39) L517F probably benign Het
Atxn7l1 C T 12: 33,392,150 (GRCm39) P242L possibly damaging Het
AY761185 T A 8: 21,434,616 (GRCm39) E37D possibly damaging Het
Babam1 T A 8: 71,851,050 (GRCm39) D104E probably damaging Het
Batf A T 12: 85,755,446 (GRCm39) T100S probably benign Het
Blcap A T 2: 157,399,897 (GRCm39) Y59* probably null Het
Cacnb3 G A 15: 98,540,440 (GRCm39) A350T probably damaging Het
Cdk15 T A 1: 59,349,965 (GRCm39) V319D probably damaging Het
Cenpf T C 1: 189,382,911 (GRCm39) H2661R probably benign Het
Cenpq T C 17: 41,240,941 (GRCm39) E106G probably damaging Het
Cfap43 A G 19: 47,785,642 (GRCm39) probably benign Het
Cfb G A 17: 35,079,362 (GRCm39) S778L possibly damaging Het
Clec2m A T 6: 129,302,571 (GRCm39) L152* probably null Het
Clspn T A 4: 126,467,029 (GRCm39) N631K probably damaging Het
Cntn2 T A 1: 132,449,462 (GRCm39) T660S probably damaging Het
Cntrob T A 11: 69,202,167 (GRCm39) H475L possibly damaging Het
Ddx46 T C 13: 55,821,917 (GRCm39) I863T probably benign Het
Dnah11 G A 12: 118,004,748 (GRCm39) T2191I probably damaging Het
Dock9 T C 14: 121,813,411 (GRCm39) T1703A probably benign Het
Fam13c C T 10: 70,380,343 (GRCm39) P424S probably benign Het
Fan1 T C 7: 63,998,619 (GRCm39) N968D probably benign Het
Fbxl20 A T 11: 97,989,329 (GRCm39) probably benign Het
Fkbp1b A T 12: 4,888,229 (GRCm39) probably benign Het
G930045G22Rik T A 6: 50,824,039 (GRCm39) noncoding transcript Het
Gm28042 C A 2: 119,872,073 (GRCm39) R1008S probably benign Het
Gon4l G A 3: 88,765,707 (GRCm39) S376N probably damaging Het
Gstt3 C A 10: 75,616,749 (GRCm39) R15L probably damaging Het
Gtdc1 A T 2: 44,642,186 (GRCm39) S73T possibly damaging Het
Hhatl A G 9: 121,613,786 (GRCm39) S419P probably benign Het
Hirip3 T G 7: 126,462,363 (GRCm39) S46R probably damaging Het
Hsf2 A G 10: 57,378,735 (GRCm39) T204A probably benign Het
Impg2 G A 16: 56,089,378 (GRCm39) E1108K possibly damaging Het
Itgb2l G T 16: 96,224,130 (GRCm39) probably benign Het
Itih5 A T 2: 10,256,075 (GRCm39) N847I probably benign Het
Kif1a T C 1: 92,982,164 (GRCm39) probably benign Het
Klhl1 T A 14: 96,755,780 (GRCm39) probably benign Het
Ktn1 T A 14: 47,952,119 (GRCm39) D963E probably benign Het
Lclat1 T A 17: 73,547,022 (GRCm39) V313E probably benign Het
Lrrn4 T C 2: 132,712,639 (GRCm39) S395G probably benign Het
Macroh2a1 G A 13: 56,243,927 (GRCm39) probably benign Het
Mbtps1 G A 8: 120,264,856 (GRCm39) probably benign Het
Me1 A G 9: 86,478,257 (GRCm39) probably benign Het
Mov10 C A 3: 104,702,721 (GRCm39) C948F probably benign Het
Mterf1a G A 5: 3,940,990 (GRCm39) Q293* probably null Het
Nfkb2 A T 19: 46,300,065 (GRCm39) M838L possibly damaging Het
Nhlrc2 T A 19: 56,540,302 (GRCm39) L97Q probably damaging Het
Nr6a1 A T 2: 38,629,032 (GRCm39) Y331N possibly damaging Het
Nup214 C T 2: 31,924,826 (GRCm39) A1785V probably damaging Het
Ogg1 C T 6: 113,306,217 (GRCm39) T138I probably benign Het
Or5ac20 A G 16: 59,104,116 (GRCm39) V248A probably damaging Het
Or5b107 A G 19: 13,143,251 (GRCm39) Y291C probably damaging Het
Or5b124 A G 19: 13,611,048 (GRCm39) Y191C probably damaging Het
Or7g17 T A 9: 18,768,127 (GRCm39) Y60N probably damaging Het
Plod2 G T 9: 92,466,574 (GRCm39) R178L probably benign Het
Polr3b T A 10: 84,554,339 (GRCm39) L1017Q probably benign Het
Postn C A 3: 54,291,971 (GRCm39) T724N probably damaging Het
Ppm1l T G 3: 69,225,309 (GRCm39) probably benign Het
Prpf8 T G 11: 75,396,075 (GRCm39) L1983R probably damaging Het
Psma7 A G 2: 179,681,193 (GRCm39) V59A probably benign Het
Qser1 T A 2: 104,619,306 (GRCm39) Y502F probably benign Het
Rad50 T C 11: 53,558,852 (GRCm39) D1129G probably damaging Het
Rasal1 C A 5: 120,812,794 (GRCm39) P606Q probably damaging Het
Rgs6 A G 12: 83,180,463 (GRCm39) Y438C probably damaging Het
Rnf180 A G 13: 105,388,774 (GRCm39) C73R probably benign Het
Rnf216 T A 5: 143,065,996 (GRCm39) I474F possibly damaging Het
Sdha A T 13: 74,480,366 (GRCm39) L371Q probably damaging Het
Sdk1 T G 5: 142,070,321 (GRCm39) L1162R possibly damaging Het
Sh3rf2 T C 18: 42,237,146 (GRCm39) I223T probably damaging Het
Sirpb1a A G 3: 15,475,587 (GRCm39) V316A probably damaging Het
Slc12a4 A T 8: 106,672,021 (GRCm39) I897N probably benign Het
Slc35d1 A T 4: 103,048,035 (GRCm39) V243E probably damaging Het
Slc4a11 T A 2: 130,532,852 (GRCm39) K200N possibly damaging Het
Slc9a8 T A 2: 167,293,216 (GRCm39) M188K probably damaging Het
Slco1a8 T A 6: 141,918,137 (GRCm39) I580F possibly damaging Het
Snrnp200 T C 2: 127,074,902 (GRCm39) S1492P probably damaging Het
Sphk2 T C 7: 45,360,149 (GRCm39) *618W probably null Het
Sytl2 T C 7: 90,052,228 (GRCm39) probably benign Het
Tdpoz3 A G 3: 93,734,231 (GRCm39) N302S probably benign Het
Tdrd6 T C 17: 43,935,199 (GRCm39) M1950V probably benign Het
Tmem39a A G 16: 38,384,675 (GRCm39) probably benign Het
Trip4 A T 9: 65,765,640 (GRCm39) I353K probably damaging Het
Trip6 A T 5: 137,311,103 (GRCm39) F204L probably benign Het
Trpm4 T A 7: 44,968,677 (GRCm39) I419F possibly damaging Het
Ttn C A 2: 76,775,140 (GRCm39) E1967D probably damaging Het
Uba2 C T 7: 33,850,281 (GRCm39) V391M possibly damaging Het
Ubr4 T G 4: 139,206,746 (GRCm39) probably benign Het
Upf1 G A 8: 70,788,295 (GRCm39) probably benign Het
Vmn2r79 A G 7: 86,652,594 (GRCm39) M429V probably benign Het
Vps36 C T 8: 22,700,472 (GRCm39) T210I possibly damaging Het
Wdr17 C T 8: 55,146,131 (GRCm39) A90T possibly damaging Het
Ybx1 C T 4: 119,138,788 (GRCm39) G126D probably benign Het
Yipf5 C A 18: 40,339,460 (GRCm39) probably benign Het
Zbtb47 A G 9: 121,596,641 (GRCm39) T666A probably benign Het
Zdhhc5 A C 2: 84,520,459 (GRCm39) S573A probably benign Het
Zfp457 A T 13: 67,441,991 (GRCm39) C99S probably damaging Het
Zfp52 T A 17: 21,781,564 (GRCm39) C471S probably damaging Het
Zfp558 C T 9: 18,379,252 (GRCm39) V71I probably damaging Het
Zfp655 A G 5: 145,181,267 (GRCm39) Y375C probably damaging Het
Zfp882 A T 8: 72,668,459 (GRCm39) T429S probably benign Het
Zmym2 T C 14: 57,187,141 (GRCm39) probably null Het
Other mutations in Vmn1r228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Vmn1r228 APN 17 20,996,774 (GRCm39) missense probably benign 0.07
IGL03275:Vmn1r228 APN 17 20,997,104 (GRCm39) missense probably damaging 1.00
PIT4498001:Vmn1r228 UTSW 17 20,996,772 (GRCm39) missense probably benign 0.00
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0279:Vmn1r228 UTSW 17 20,996,637 (GRCm39) missense probably benign 0.02
R1544:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R1695:Vmn1r228 UTSW 17 20,996,560 (GRCm39) missense possibly damaging 0.49
R2086:Vmn1r228 UTSW 17 20,997,455 (GRCm39) missense possibly damaging 0.71
R2275:Vmn1r228 UTSW 17 20,996,807 (GRCm39) missense probably damaging 1.00
R2965:Vmn1r228 UTSW 17 20,996,609 (GRCm39) missense probably damaging 0.99
R4425:Vmn1r228 UTSW 17 20,996,861 (GRCm39) missense probably damaging 1.00
R4447:Vmn1r228 UTSW 17 20,997,369 (GRCm39) missense probably damaging 0.96
R5031:Vmn1r228 UTSW 17 20,996,943 (GRCm39) nonsense probably null
R6345:Vmn1r228 UTSW 17 20,997,144 (GRCm39) missense probably damaging 1.00
R7064:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R7880:Vmn1r228 UTSW 17 20,996,672 (GRCm39) missense probably damaging 1.00
R8000:Vmn1r228 UTSW 17 20,997,227 (GRCm39) missense possibly damaging 0.88
R8290:Vmn1r228 UTSW 17 20,996,724 (GRCm39) missense probably benign 0.09
R9022:Vmn1r228 UTSW 17 20,996,778 (GRCm39) missense probably damaging 1.00
R9027:Vmn1r228 UTSW 17 20,997,422 (GRCm39) missense probably benign 0.01
R9291:Vmn1r228 UTSW 17 20,997,023 (GRCm39) missense probably benign
R9492:Vmn1r228 UTSW 17 20,996,862 (GRCm39) missense probably damaging 1.00
R9618:Vmn1r228 UTSW 17 20,997,045 (GRCm39) missense probably benign 0.00
X0018:Vmn1r228 UTSW 17 20,996,963 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGACCAGAATGGTCTGTGTTGCTC -3'
(R):5'- AACGCCTTGATCCTTCTCTCCAAAG -3'

Sequencing Primer
(F):5'- CTGTTTTCAGCAGAGATTCTAAGAG -3'
(R):5'- CCAGTAACTCCTGCTGGAAG -3'
Posted On 2013-05-09