Incidental Mutation 'R4659:Ttll3'
ID352673
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Nametubulin tyrosine ligase-like family, member 3
Synonyms
MMRRC Submission 041919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4659 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113389260-113414587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113414141 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 896 (I896V)
Ref Sequence ENSEMBL: ENSMUSP00000037870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000060634] [ENSMUST00000113092] [ENSMUST00000129047] [ENSMUST00000129560] [ENSMUST00000205017]
Predicted Effect probably benign
Transcript: ENSMUST00000032414
AA Change: I895V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: I895V

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038889
AA Change: I896V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: I896V

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060634
SMART Domains Protein: ENSMUSP00000059057
Gene: ENSMUSG00000051169

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 82 236 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113092
SMART Domains Protein: ENSMUSP00000108715
Gene: ENSMUSG00000051169

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 82 246 7.4e-20 PFAM
low complexity region 303 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124368
AA Change: D137G
Predicted Effect probably benign
Transcript: ENSMUST00000129047
SMART Domains Protein: ENSMUSP00000120380
Gene: ENSMUSG00000051169

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 82 246 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134853
Predicted Effect probably benign
Transcript: ENSMUST00000147726
SMART Domains Protein: ENSMUSP00000120250
Gene: ENSMUSG00000051169

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 71 235 2.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150452
Predicted Effect probably benign
Transcript: ENSMUST00000151618
SMART Domains Protein: ENSMUSP00000115950
Gene: ENSMUSG00000051169

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 72 179 5.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161831
AA Change: D699G
Predicted Effect probably benign
Transcript: ENSMUST00000203524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204498
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,216,276 probably benign Het
Abcc9 C A 6: 142,672,595 probably null Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Mx1 T C 16: 97,455,239 probably null Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Myt1l A G 12: 29,849,457 N153D probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Notch1 T C 2: 26,470,889 E1148G probably damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Nwd1 T A 8: 72,695,321 D998E probably benign Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pitrm1 T A 13: 6,553,182 S88R probably benign Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Sec24c G T 14: 20,683,144 G180C probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Thsd1 C A 8: 22,259,298 Y667* probably null Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Txnip T G 3: 96,559,427 F190C probably damaging Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113412934 missense probably benign 0.31
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2903:Ttll3 UTSW 6 113407323 missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5372:Ttll3 UTSW 6 113401421 nonsense probably null
R5525:Ttll3 UTSW 6 113412978 missense probably benign
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399157 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6853:Ttll3 UTSW 6 113399157 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7302:Ttll3 UTSW 6 113409285 missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
R7774:Ttll3 UTSW 6 113399160 frame shift probably null
R7775:Ttll3 UTSW 6 113399158 nonsense probably null
R7775:Ttll3 UTSW 6 113399160 frame shift probably null
R7776:Ttll3 UTSW 6 113399159 frame shift probably null
R7793:Ttll3 UTSW 6 113399158 frame shift probably null
R7793:Ttll3 UTSW 6 113399159 frame shift probably null
R7797:Ttll3 UTSW 6 113394777 missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113399157 frame shift probably null
R7824:Ttll3 UTSW 6 113399161 frame shift probably null
R7824:Ttll3 UTSW 6 113399164 frame shift probably null
R7825:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399157 frame shift probably null
R7826:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399160 frame shift probably null
R7826:Ttll3 UTSW 6 113399161 frame shift probably null
R7827:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399162 frame shift probably null
R7831:Ttll3 UTSW 6 113399155 frame shift probably null
R7831:Ttll3 UTSW 6 113399157 frame shift probably null
R7831:Ttll3 UTSW 6 113399159 frame shift probably null
R7832:Ttll3 UTSW 6 113399155 frame shift probably null
R7832:Ttll3 UTSW 6 113399157 frame shift probably null
R7833:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
R7914:Ttll3 UTSW 6 113399157 frame shift probably null
R7915:Ttll3 UTSW 6 113399157 frame shift probably null
R7916:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTAAGGCTCTGTCAACC -3'
(R):5'- GGCCTTGAACTTGCCTTTGC -3'

Sequencing Primer
(F):5'- TGTCAACCACAGGCAAGG -3'
(R):5'- AAGTCCGGCTTCAAAGGGC -3'
Posted On2015-10-08