Incidental Mutation 'R4659:Thsd1'
ID352679
Institutional Source Beutler Lab
Gene Symbol Thsd1
Ensembl Gene ENSMUSG00000031480
Gene Namethrombospondin, type I, domain 1
SynonymsTmtsp, 4833423O18Rik
MMRRC Submission 041919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4659 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22227313-22261334 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 22259298 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 667 (Y667*)
Ref Sequence ENSEMBL: ENSMUSP00000148214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069828] [ENSMUST00000160585] [ENSMUST00000162447]
Predicted Effect probably null
Transcript: ENSMUST00000069828
AA Change: Y728*
SMART Domains Protein: ENSMUSP00000067701
Gene: ENSMUSG00000031480
AA Change: Y728*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSP1 342 392 4.55e-8 SMART
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160585
AA Change: Y675*
SMART Domains Protein: ENSMUSP00000125118
Gene: ENSMUSG00000031480
AA Change: Y675*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 343 355 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162447
AA Change: Y667*
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a type 1 thrombospondin domain, which is found in a number of proteins involved in the complement pathway, as well as in extracellular matrix proteins. Alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,216,276 probably benign Het
Abcc9 C A 6: 142,672,595 probably null Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Mx1 T C 16: 97,455,239 probably null Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Myt1l A G 12: 29,849,457 N153D probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Notch1 T C 2: 26,470,889 E1148G probably damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Nwd1 T A 8: 72,695,321 D998E probably benign Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pitrm1 T A 13: 6,553,182 S88R probably benign Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Sec24c G T 14: 20,683,144 G180C probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Ttll3 A G 6: 113,414,141 I896V probably benign Het
Txnip T G 3: 96,559,427 F190C probably damaging Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in Thsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Thsd1 APN 8 22252231 missense probably damaging 1.00
IGL02288:Thsd1 APN 8 22259549 missense probably damaging 1.00
IGL02517:Thsd1 APN 8 22243438 missense probably damaging 1.00
IGL02591:Thsd1 APN 8 22258727 missense probably damaging 1.00
IGL03378:Thsd1 APN 8 22243778 missense probably benign 0.13
R0137:Thsd1 UTSW 8 22243039 missense probably damaging 1.00
R0507:Thsd1 UTSW 8 22258679 missense probably damaging 1.00
R0854:Thsd1 UTSW 8 22258571 missense probably damaging 0.99
R1109:Thsd1 UTSW 8 22243692 missense possibly damaging 0.93
R1402:Thsd1 UTSW 8 22259368 missense possibly damaging 0.68
R1402:Thsd1 UTSW 8 22259368 missense possibly damaging 0.68
R1899:Thsd1 UTSW 8 22252318 splice site probably benign
R1900:Thsd1 UTSW 8 22252318 splice site probably benign
R2008:Thsd1 UTSW 8 22259231 missense probably benign 0.23
R2048:Thsd1 UTSW 8 22259317 missense probably benign 0.01
R2090:Thsd1 UTSW 8 22259657 missense possibly damaging 0.95
R2165:Thsd1 UTSW 8 22238522 intron probably benign
R2209:Thsd1 UTSW 8 22258871 missense probably damaging 1.00
R3831:Thsd1 UTSW 8 22243116 missense possibly damaging 0.92
R3833:Thsd1 UTSW 8 22243116 missense possibly damaging 0.92
R3847:Thsd1 UTSW 8 22259411 missense probably damaging 0.97
R4049:Thsd1 UTSW 8 22243164 missense possibly damaging 0.75
R4454:Thsd1 UTSW 8 22243578 missense probably damaging 1.00
R4997:Thsd1 UTSW 8 22243324 missense probably damaging 0.98
R6440:Thsd1 UTSW 8 22258553 missense possibly damaging 0.59
R6457:Thsd1 UTSW 8 22243347 missense probably damaging 0.97
R6488:Thsd1 UTSW 8 22243717 missense probably benign 0.36
R6519:Thsd1 UTSW 8 22259065 missense probably damaging 1.00
R7267:Thsd1 UTSW 8 22243581 missense probably benign 0.10
R7448:Thsd1 UTSW 8 22243333 missense possibly damaging 0.89
R7698:Thsd1 UTSW 8 22258987 nonsense probably null
R7733:Thsd1 UTSW 8 22258721 missense probably damaging 1.00
R7792:Thsd1 UTSW 8 22243098 missense probably damaging 0.99
R7894:Thsd1 UTSW 8 22259569 missense probably damaging 0.99
R7977:Thsd1 UTSW 8 22259569 missense probably damaging 0.99
X0023:Thsd1 UTSW 8 22259567 missense probably damaging 1.00
Z1088:Thsd1 UTSW 8 22252219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAACCAAGCAGTCTCGCC -3'
(R):5'- TAAGCTGACTGACTTTCTGGTAGC -3'

Sequencing Primer
(F):5'- GAGAGGAGTTTGTCAGCCC -3'
(R):5'- CTGGTAGCTATCTTTGAGGAAAATG -3'
Posted On2015-10-08